ID: 1046503402

View in Genome Browser
Species Human (GRCh38)
Location 8:115107979-115108001
Sequence AAAAAGCTGAATTTTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046503397_1046503402 16 Left 1046503397 8:115107940-115107962 CCCTTTTCTACTGATGTGATTTG No data
Right 1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG No data
1046503398_1046503402 15 Left 1046503398 8:115107941-115107963 CCTTTTCTACTGATGTGATTTGA No data
Right 1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG No data
1046503396_1046503402 26 Left 1046503396 8:115107930-115107952 CCAAATTCTGCCCTTTTCTACTG No data
Right 1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG No data
1046503395_1046503402 29 Left 1046503395 8:115107927-115107949 CCTCCAAATTCTGCCCTTTTCTA No data
Right 1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046503402 Original CRISPR AAAAAGCTGAATTTTAGGCC AGG Intergenic
No off target data available for this crispr