ID: 1046504372

View in Genome Browser
Species Human (GRCh38)
Location 8:115117911-115117933
Sequence GCAACCAGTCATATTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046504372_1046504374 17 Left 1046504372 8:115117911-115117933 CCTCTTTGAATATGACTGGTTGC No data
Right 1046504374 8:115117951-115117973 ATGTGTGTACACAGCCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046504372 Original CRISPR GCAACCAGTCATATTCAAAG AGG (reversed) Intergenic
No off target data available for this crispr