ID: 1046508772

View in Genome Browser
Species Human (GRCh38)
Location 8:115171938-115171960
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046508772_1046508776 -6 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508776 8:115171955-115171977 ATAAAGACATACCCAAGGCTGGG 0: 83
1: 2311
2: 4383
3: 7887
4: 9880
1046508772_1046508775 -7 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508775 8:115171954-115171976 AATAAAGACATACCCAAGGCTGG 0: 42
1: 979
2: 3093
3: 5607
4: 7850
1046508772_1046508779 7 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508779 8:115171968-115171990 CAAGGCTGGGTAATTTATAAAGG 0: 61
1: 1536
2: 2654
3: 4262
4: 3770
1046508772_1046508780 14 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508780 8:115171975-115171997 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
1046508772_1046508781 30 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508781 8:115171991-115172013 AAAGAGGTTTAATTGATTCACGG 0: 22
1: 358
2: 1860
3: 2644
4: 2639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046508772 Original CRISPR CTTTATTAGTAGTGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr