ID: 1046508775

View in Genome Browser
Species Human (GRCh38)
Location 8:115171954-115171976
Sequence AATAAAGACATACCCAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17571
Summary {0: 42, 1: 979, 2: 3093, 3: 5607, 4: 7850}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046508771_1046508775 7 Left 1046508771 8:115171924-115171946 CCAGTTGTATTAGTCCATCCTCA No data
Right 1046508775 8:115171954-115171976 AATAAAGACATACCCAAGGCTGG 0: 42
1: 979
2: 3093
3: 5607
4: 7850
1046508772_1046508775 -7 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508775 8:115171954-115171976 AATAAAGACATACCCAAGGCTGG 0: 42
1: 979
2: 3093
3: 5607
4: 7850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046508775 Original CRISPR AATAAAGACATACCCAAGGC TGG Intergenic
Too many off-targets to display for this crispr