ID: 1046508776

View in Genome Browser
Species Human (GRCh38)
Location 8:115171955-115171977
Sequence ATAAAGACATACCCAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24544
Summary {0: 83, 1: 2311, 2: 4383, 3: 7887, 4: 9880}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046508772_1046508776 -6 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508776 8:115171955-115171977 ATAAAGACATACCCAAGGCTGGG 0: 83
1: 2311
2: 4383
3: 7887
4: 9880
1046508773_1046508776 -10 Left 1046508773 8:115171942-115171964 CCTCACACTACTAATAAAGACAT No data
Right 1046508776 8:115171955-115171977 ATAAAGACATACCCAAGGCTGGG 0: 83
1: 2311
2: 4383
3: 7887
4: 9880
1046508771_1046508776 8 Left 1046508771 8:115171924-115171946 CCAGTTGTATTAGTCCATCCTCA No data
Right 1046508776 8:115171955-115171977 ATAAAGACATACCCAAGGCTGGG 0: 83
1: 2311
2: 4383
3: 7887
4: 9880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046508776 Original CRISPR ATAAAGACATACCCAAGGCT GGG Intergenic
Too many off-targets to display for this crispr