ID: 1046508779

View in Genome Browser
Species Human (GRCh38)
Location 8:115171968-115171990
Sequence CAAGGCTGGGTAATTTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12283
Summary {0: 61, 1: 1536, 2: 2654, 3: 4262, 4: 3770}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046508773_1046508779 3 Left 1046508773 8:115171942-115171964 CCTCACACTACTAATAAAGACAT No data
Right 1046508779 8:115171968-115171990 CAAGGCTGGGTAATTTATAAAGG 0: 61
1: 1536
2: 2654
3: 4262
4: 3770
1046508771_1046508779 21 Left 1046508771 8:115171924-115171946 CCAGTTGTATTAGTCCATCCTCA No data
Right 1046508779 8:115171968-115171990 CAAGGCTGGGTAATTTATAAAGG 0: 61
1: 1536
2: 2654
3: 4262
4: 3770
1046508772_1046508779 7 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508779 8:115171968-115171990 CAAGGCTGGGTAATTTATAAAGG 0: 61
1: 1536
2: 2654
3: 4262
4: 3770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046508779 Original CRISPR CAAGGCTGGGTAATTTATAA AGG Intergenic
Too many off-targets to display for this crispr