ID: 1046508780

View in Genome Browser
Species Human (GRCh38)
Location 8:115171975-115171997
Sequence GGGTAATTTATAAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33672
Summary {0: 3442, 1: 8020, 2: 8919, 3: 8212, 4: 5079}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046508773_1046508780 10 Left 1046508773 8:115171942-115171964 CCTCACACTACTAATAAAGACAT No data
Right 1046508780 8:115171975-115171997 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
1046508772_1046508780 14 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508780 8:115171975-115171997 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
1046508771_1046508780 28 Left 1046508771 8:115171924-115171946 CCAGTTGTATTAGTCCATCCTCA No data
Right 1046508780 8:115171975-115171997 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046508780 Original CRISPR GGGTAATTTATAAAGGAAAG AGG Intergenic
Too many off-targets to display for this crispr