ID: 1046508781

View in Genome Browser
Species Human (GRCh38)
Location 8:115171991-115172013
Sequence AAAGAGGTTTAATTGATTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7523
Summary {0: 22, 1: 358, 2: 1860, 3: 2644, 4: 2639}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046508772_1046508781 30 Left 1046508772 8:115171938-115171960 CCATCCTCACACTACTAATAAAG No data
Right 1046508781 8:115171991-115172013 AAAGAGGTTTAATTGATTCACGG 0: 22
1: 358
2: 1860
3: 2644
4: 2639
1046508777_1046508781 2 Left 1046508777 8:115171966-115171988 CCCAAGGCTGGGTAATTTATAAA 0: 166
1: 3729
2: 12174
3: 14856
4: 12643
Right 1046508781 8:115171991-115172013 AAAGAGGTTTAATTGATTCACGG 0: 22
1: 358
2: 1860
3: 2644
4: 2639
1046508773_1046508781 26 Left 1046508773 8:115171942-115171964 CCTCACACTACTAATAAAGACAT No data
Right 1046508781 8:115171991-115172013 AAAGAGGTTTAATTGATTCACGG 0: 22
1: 358
2: 1860
3: 2644
4: 2639
1046508778_1046508781 1 Left 1046508778 8:115171967-115171989 CCAAGGCTGGGTAATTTATAAAG 0: 194
1: 3842
2: 4531
3: 3228
4: 3341
Right 1046508781 8:115171991-115172013 AAAGAGGTTTAATTGATTCACGG 0: 22
1: 358
2: 1860
3: 2644
4: 2639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046508781 Original CRISPR AAAGAGGTTTAATTGATTCA CGG Intergenic
Too many off-targets to display for this crispr