ID: 1046510303

View in Genome Browser
Species Human (GRCh38)
Location 8:115193940-115193962
Sequence CTGTTGCTCAGAAGCAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046510300_1046510303 -10 Left 1046510300 8:115193927-115193949 CCCTCCTCTGCTTCTGTTGCTCA No data
Right 1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG No data
1046510299_1046510303 21 Left 1046510299 8:115193896-115193918 CCTGAGAAAAACGCAATAGAGGA No data
Right 1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG No data
1046510297_1046510303 22 Left 1046510297 8:115193895-115193917 CCCTGAGAAAAACGCAATAGAGG No data
Right 1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046510303 Original CRISPR CTGTTGCTCAGAAGCAAGCA TGG Intergenic
No off target data available for this crispr