ID: 1046511457

View in Genome Browser
Species Human (GRCh38)
Location 8:115209616-115209638
Sequence CATCTTCAGCAACTGTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046511456_1046511457 6 Left 1046511456 8:115209587-115209609 CCTAACTTGTTGTCTACTTTACA No data
Right 1046511457 8:115209616-115209638 CATCTTCAGCAACTGTACTTTGG No data
1046511455_1046511457 7 Left 1046511455 8:115209586-115209608 CCCTAACTTGTTGTCTACTTTAC No data
Right 1046511457 8:115209616-115209638 CATCTTCAGCAACTGTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046511457 Original CRISPR CATCTTCAGCAACTGTACTT TGG Intergenic
No off target data available for this crispr