ID: 1046520920 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:115324593-115324615 |
| Sequence | CAGTGTCACTAAAGGCAAAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046520918_1046520920 | 0 | Left | 1046520918 | 8:115324570-115324592 | CCACATAAGGGGTACAGTTGTAA | No data | ||
| Right | 1046520920 | 8:115324593-115324615 | CAGTGTCACTAAAGGCAAATTGG | No data | ||||
| 1046520913_1046520920 | 14 | Left | 1046520913 | 8:115324556-115324578 | CCAAAATCTATTACCCACATAAG | No data | ||
| Right | 1046520920 | 8:115324593-115324615 | CAGTGTCACTAAAGGCAAATTGG | No data | ||||
| 1046520917_1046520920 | 1 | Left | 1046520917 | 8:115324569-115324591 | CCCACATAAGGGGTACAGTTGTA | No data | ||
| Right | 1046520920 | 8:115324593-115324615 | CAGTGTCACTAAAGGCAAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046520920 | Original CRISPR | CAGTGTCACTAAAGGCAAAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||