ID: 1046520920

View in Genome Browser
Species Human (GRCh38)
Location 8:115324593-115324615
Sequence CAGTGTCACTAAAGGCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046520918_1046520920 0 Left 1046520918 8:115324570-115324592 CCACATAAGGGGTACAGTTGTAA No data
Right 1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG No data
1046520913_1046520920 14 Left 1046520913 8:115324556-115324578 CCAAAATCTATTACCCACATAAG No data
Right 1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG No data
1046520917_1046520920 1 Left 1046520917 8:115324569-115324591 CCCACATAAGGGGTACAGTTGTA No data
Right 1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046520920 Original CRISPR CAGTGTCACTAAAGGCAAAT TGG Intergenic
No off target data available for this crispr