ID: 1046521421

View in Genome Browser
Species Human (GRCh38)
Location 8:115330880-115330902
Sequence GGCCAGCGCAAGGGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046521421_1046521428 1 Left 1046521421 8:115330880-115330902 CCATGCCCACCCTTGCGCTGGCC No data
Right 1046521428 8:115330904-115330926 GTGAGTGCCACGCGCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046521421 Original CRISPR GGCCAGCGCAAGGGTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr