ID: 1046524045

View in Genome Browser
Species Human (GRCh38)
Location 8:115361314-115361336
Sequence TACTTTTACTAGAATTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046524045_1046524046 -10 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524046 8:115361327-115361349 AGTAAAAGTACATTGCAGCAAGG No data
1046524045_1046524050 4 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524050 8:115361341-115361363 GCAGCAAGGGGAGACCGTGGCGG No data
1046524045_1046524053 26 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524053 8:115361363-115361385 GGCTTCAAGCCAAAACAGATTGG No data
1046524045_1046524049 1 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524049 8:115361338-115361360 ATTGCAGCAAGGGGAGACCGTGG No data
1046524045_1046524054 27 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524054 8:115361364-115361386 GCTTCAAGCCAAAACAGATTGGG No data
1046524045_1046524047 -9 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524047 8:115361328-115361350 GTAAAAGTACATTGCAGCAAGGG No data
1046524045_1046524051 5 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG No data
1046524045_1046524048 -8 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524048 8:115361329-115361351 TAAAAGTACATTGCAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046524045 Original CRISPR TACTTTTACTAGAATTCTCA TGG (reversed) Intergenic
No off target data available for this crispr