ID: 1046524051

View in Genome Browser
Species Human (GRCh38)
Location 8:115361342-115361364
Sequence CAGCAAGGGGAGACCGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046524045_1046524051 5 Left 1046524045 8:115361314-115361336 CCATGAGAATTCTAGTAAAAGTA No data
Right 1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046524051 Original CRISPR CAGCAAGGGGAGACCGTGGC GGG Intergenic
No off target data available for this crispr