ID: 1046528705

View in Genome Browser
Species Human (GRCh38)
Location 8:115415574-115415596
Sequence CTGGAGACAGGGTCCTTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046528702_1046528705 -6 Left 1046528702 8:115415557-115415579 CCACAGTGTGACTGTGTCTGGAG 0: 2
1: 6
2: 82
3: 357
4: 1179
Right 1046528705 8:115415574-115415596 CTGGAGACAGGGTCCTTAGTAGG No data
1046528699_1046528705 1 Left 1046528699 8:115415550-115415572 CCCTAAACCACAGTGTGACTGTG 0: 1
1: 0
2: 8
3: 74
4: 490
Right 1046528705 8:115415574-115415596 CTGGAGACAGGGTCCTTAGTAGG No data
1046528700_1046528705 0 Left 1046528700 8:115415551-115415573 CCTAAACCACAGTGTGACTGTGT 0: 1
1: 0
2: 12
3: 102
4: 530
Right 1046528705 8:115415574-115415596 CTGGAGACAGGGTCCTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046528705 Original CRISPR CTGGAGACAGGGTCCTTAGT AGG Intronic
No off target data available for this crispr