ID: 1046529110

View in Genome Browser
Species Human (GRCh38)
Location 8:115420908-115420930
Sequence GACTTGCCCAGTGTTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046529110 Original CRISPR GACTTGCCCAGTGTTGTACC TGG (reversed) Intronic
900482998 1:2908387-2908409 CACTTGCCCTGTGCTGTTCCTGG + Intergenic
900780604 1:4615139-4615161 GGCTTCCCCAGTGTGGTGCCTGG + Intergenic
902820505 1:18940337-18940359 GACTTGCCCAAAGTTGCACGGGG - Intronic
903177873 1:21591330-21591352 GACTTGCCCAGTGTCATGCCAGG + Intergenic
903342875 1:22665560-22665582 GACTTGCCGGGCGTTGAACCTGG - Intergenic
904089563 1:27935241-27935263 GACATTCCCAGTGCTGTACCTGG - Exonic
905632450 1:39526191-39526213 GAAATGGCCAGTGTTGTACCTGG - Intergenic
909820169 1:80051543-80051565 GACTTTCACAGTGTTGTCGCAGG + Intergenic
912415713 1:109507281-109507303 GTCTTGCTCTCTGTTGTACCTGG + Exonic
912606795 1:110999395-110999417 GATTTGCCCAGTGTTGAAATTGG + Intergenic
923638320 1:235723788-235723810 AACTTGCTCAGTGCTGTAGCAGG - Intronic
1066523270 10:36247011-36247033 GACTTGACCAGTGTGGCAGCTGG - Intergenic
1069760275 10:70805783-70805805 GACTTGCCCAATGTTGTCTCAGG - Intergenic
1069871446 10:71535618-71535640 GACTTGACCTGTGTTCTGCCTGG + Intronic
1072226445 10:93374381-93374403 AACTTGCCCAATGTTATACATGG + Intronic
1074714014 10:116201753-116201775 TACTTGCCCAGGTTTGTACAAGG - Intronic
1075540770 10:123311812-123311834 AACTTGCTCACTGTTGTACATGG - Intergenic
1076249622 10:128975330-128975352 GACCTGCCCAGAGTTGTACATGG + Intergenic
1078157510 11:8811369-8811391 GACTTGCCCAGGATTCTTCCTGG - Intronic
1081657104 11:44864629-44864651 GACTGGTCCAGTGTTGCACATGG + Intronic
1083178763 11:60971091-60971113 GGCATGCCCAGTCTGGTACCTGG + Intergenic
1085469547 11:76748452-76748474 GCCTTCCCCAGTTTTGTCCCAGG - Intergenic
1086491645 11:87362206-87362228 GACTTTCACAGTGTTGTCGCAGG + Intergenic
1087938363 11:104062263-104062285 AACTTGCCCAAGGTTGTAACTGG - Intronic
1088722294 11:112604779-112604801 AATTTGCCCACTGTTGTACAGGG + Intergenic
1091656053 12:2347777-2347799 GACCTGCCCAGTGATGTCCCTGG + Intronic
1097754868 12:63398248-63398270 GACTTTCACAGTGTTGTTGCAGG + Intergenic
1097999345 12:65923510-65923532 GACTGGTCCAGTGCTGTAGCTGG - Intronic
1102463571 12:113115041-113115063 GCCTTGCCCTGAGTTGCACCTGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1113641191 13:111958060-111958082 GACTTGACCGAGGTTGTACCCGG - Intergenic
1114007079 14:18325728-18325750 GACTTGACCAATGTTTCACCTGG + Intergenic
1118458050 14:65962578-65962600 GACTTTCCCAGTTTTGAAACTGG - Intronic
1121289715 14:92764014-92764036 GACTTGCCCGGTCTAGTTCCTGG - Intergenic
1121291477 14:92779486-92779508 GACTTGCCCGGTCTAGTTCCTGG + Intergenic
1123390994 15:19872372-19872394 GACTTGACCAATGTTTCACCTGG + Intergenic
1124600627 15:31130177-31130199 GACCTGCCCAGTGTCTTACCTGG + Intronic
1128188589 15:65667489-65667511 GACTTGCCCAGTAACTTACCTGG - Exonic
1130381681 15:83377593-83377615 AACTTGCCCGATGTTATACCAGG + Intergenic
1133767149 16:8846039-8846061 GCCTTACACAGTTTTGTACCAGG - Intronic
1136666472 16:31817030-31817052 GACTTGCTCATGGTGGTACCAGG - Intergenic
1136933952 16:34441773-34441795 GAGTTCTCCAGTGTTGTCCCAGG - Intergenic
1136970620 16:34970041-34970063 GAGTTCTCCAGTGTTGTCCCAGG + Intergenic
1142028986 16:87829150-87829172 ACCTTGCCCAGTGATGGACCAGG - Intergenic
1142515014 17:422211-422233 GACTTGCCCAGGGTCACACCAGG + Intronic
1143367449 17:6417436-6417458 GGCTTGCCAAGTTTTGTACCTGG - Intronic
1143916500 17:10297298-10297320 GACTTGCCCAGTGTTTGAGGAGG - Intergenic
1146924202 17:36732762-36732784 GAAATCCCCAGTGCTGTACCTGG - Intergenic
1148873669 17:50673735-50673757 GACTGGCCTAGTGTTGTGCCAGG + Intronic
1149539298 17:57456626-57456648 GACTTGCCCTGTGTTGGAGATGG + Intronic
1154530389 18:15338280-15338302 GACTTGACCAATGTTTCACCTGG - Intergenic
1155387265 18:25292114-25292136 GACTTGCCCTGTGTTTTCCAGGG - Intronic
1165346450 19:35251514-35251536 GACTTGCCTAGTGTCATAGCTGG + Intronic
927491490 2:23524171-23524193 GACTTGCTCAGTGCTGTGCTAGG + Exonic
931370912 2:61661747-61661769 GACTTGCCAAGAATTGTACAAGG - Intergenic
931468019 2:62508854-62508876 CACTAGCACAGTGTGGTACCTGG + Intronic
935130465 2:100257494-100257516 GGCTTGCCCAGGGTTGTATAGGG - Intergenic
935171246 2:100612794-100612816 GGCTTGCCCAAGGTTGCACCGGG + Intergenic
938529491 2:132169748-132169770 GACTTGACCAATGTTTCACCTGG - Intronic
940525709 2:154811110-154811132 GATTTTCCCAGAGTTGTACTTGG - Intronic
946011983 2:216572690-216572712 GACTTGCTCAAGGTTGTACGAGG + Intronic
946824213 2:223659788-223659810 GACTTGTCTAGTGTTGTAAGTGG - Intergenic
947399672 2:229718472-229718494 AACTTGCCCAGTGTTGTCATGGG - Intergenic
1169548449 20:6675469-6675491 GACTTGCACAGTCTTCTACTTGG + Intergenic
1169777858 20:9275892-9275914 TACTTGTCCAGTGCTGTACAAGG + Intronic
1172692527 20:36799943-36799965 GACTTGACTGGGGTTGTACCTGG + Intronic
1174049188 20:47755829-47755851 GACTTGGCCCGGGTTGCACCAGG - Intronic
1174767205 20:53265458-53265480 AGCTTCCCCTGTGTTGTACCTGG - Intronic
1176767017 21:13030158-13030180 GACTTGACCAATGTTTCACCTGG + Intergenic
1179935808 21:44602694-44602716 GCCCTGCCCGGTGATGTACCCGG - Intronic
1180431587 22:15256538-15256560 GACTTGACCAATGTTTCACCTGG + Intergenic
1180514145 22:16124450-16124472 GACTTGACCAATGTTTCACCTGG + Intergenic
1180692200 22:17726759-17726781 GACTTGTCCAGAGTTGTCGCTGG - Exonic
1181789681 22:25255286-25255308 CACTTGTCCAAGGTTGTACCAGG + Intergenic
1181824499 22:25504121-25504143 CACTTGCCCAAGGTTGCACCAGG + Intergenic
1184273472 22:43397746-43397768 GACTTGCCCAAGGTTGTGCAGGG + Intergenic
950182891 3:10927524-10927546 GACTTGCTCGGTCGTGTACCCGG + Intronic
958429857 3:94025782-94025804 GACTTGCCCAGGATTATAGCAGG - Intronic
964559121 3:157974023-157974045 GACTTTCTCAGTGTTCTACATGG - Intergenic
969427750 4:7135638-7135660 GACCTGCCCAGTGGTTTCCCCGG + Intergenic
977442736 4:97090146-97090168 GACCTGCTCAATTTTGTACCTGG - Intergenic
978017866 4:103769781-103769803 GAACTGCCCAGGGTTGAACCAGG - Intergenic
984875338 4:184362916-184362938 GACTTGTCCAGTCTTCTACTTGG + Intergenic
985944437 5:3166437-3166459 GGCTTGCTCAGTGTTGTGCCTGG + Intergenic
987122625 5:14781376-14781398 GACTTGCCCAATGTTGTCTTGGG - Intronic
991002288 5:61794435-61794457 GAGTTGGCCATTGCTGTACCTGG + Intergenic
992758218 5:79929248-79929270 GACTTGCTCAGTGATTTACAAGG - Intergenic
1002059894 5:176620071-176620093 GAGGTGGCCAGTCTTGTACCTGG + Exonic
1002278400 5:178117398-178117420 GACTTGCCCAAGGTCGTAGCTGG - Intronic
1006802351 6:36767284-36767306 GTCTTGCCCAGAGCTGGACCTGG - Intronic
1009281574 6:61758546-61758568 GATTTGTTCAGTGTTGTACTTGG + Intronic
1013234263 6:108183176-108183198 GGCTTGCCCAGTGCTGGGCCAGG - Intronic
1015391369 6:132686033-132686055 GTCTTGTCCTGTGTTTTACCTGG - Intronic
1022363954 7:29691347-29691369 GACATAGTCAGTGTTGTACCAGG + Intergenic
1026932702 7:74232994-74233016 CACTTGCCCAGAGTTGGGCCTGG + Intronic
1027539748 7:79452986-79453008 GGCTTGCTCAGTGTTTTGCCGGG - Intronic
1038293693 8:26271860-26271882 AACTTGGCCGGTGTTGTGCCTGG - Intergenic
1038396556 8:27249961-27249983 GGCTTGAACAGAGTTGTACCTGG + Intronic
1038942302 8:32318737-32318759 GACTTGCCCAGTTTTATGACAGG + Intronic
1039198573 8:35060680-35060702 AACTTGCCCTGTGTTGTCCAGGG + Intergenic
1040333432 8:46404053-46404075 GAATTCCCCAGGGTTGTCCCAGG + Intergenic
1043386111 8:79749214-79749236 AACGTGCCCAGTGTTTTAGCTGG + Intergenic
1046529110 8:115420908-115420930 GACTTGCCCAGTGTTGTACCTGG - Intronic
1046866321 8:119154674-119154696 GACTTGCCCAAGGTTATACATGG - Intergenic
1047557274 8:125946073-125946095 GGATTGCTCAGTGTTGTTCCTGG + Intergenic
1048647448 8:136438021-136438043 GACTTGACCAGTGTTTCACCTGG - Intergenic
1049507639 8:143012182-143012204 GACTTGCCCCCTGTGGTCCCTGG + Intergenic
1053708094 9:40776014-40776036 GACTTGACCAATGTTTCACCTGG - Intergenic
1054418005 9:64896800-64896822 GACTTGACCAATGTTTCACCTGG - Intergenic
1056697996 9:88876983-88877005 GATTTGGACAGTGTTGTACCAGG + Intergenic
1059537580 9:115096922-115096944 GACTTGGCCAGAGTGGTTCCTGG - Intronic
1059824955 9:118017867-118017889 GACTAGCCCTGTGCTGTAGCTGG + Intergenic
1061523950 9:131142072-131142094 GGCTTGCAGAGTGTTGTATCAGG + Intronic
1189177278 X:38970508-38970530 GACTTTCCATGTGTTGTAGCAGG + Intergenic
1190291409 X:48995228-48995250 GACTAGCCCAGTGCTGGCCCAGG + Intronic
1192733610 X:73826813-73826835 GATTAGCCCAGGGTTGTAGCTGG - Intergenic
1193470835 X:81900961-81900983 GACTTACCCAGTTTTGCACAAGG + Intergenic
1193677105 X:84468048-84468070 GACTTGCCTGGTTATGTACCAGG + Intronic
1196018405 X:110963946-110963968 GACTTGCCCAGTTGTGTATCAGG - Intronic
1196553430 X:117058216-117058238 AACTTCTGCAGTGTTGTACCTGG + Intergenic
1198362528 X:135909704-135909726 GACTTGTCAACTGTTCTACCAGG + Exonic
1199885328 X:152015556-152015578 AGCTTGCCCTGTGGTGTACCCGG + Intergenic