ID: 1046534285

View in Genome Browser
Species Human (GRCh38)
Location 8:115488516-115488538
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1340
Summary {0: 8, 1: 66, 2: 227, 3: 440, 4: 599}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046534285_1046534294 22 Left 1046534285 8:115488516-115488538 CCCCAAAAAATTAGCTGGGCGTG 0: 8
1: 66
2: 227
3: 440
4: 599
Right 1046534294 8:115488561-115488583 GCTACTCAAAAGGCTGAGGCAGG 0: 156
1: 6519
2: 95662
3: 192951
4: 213449
1046534285_1046534290 12 Left 1046534285 8:115488516-115488538 CCCCAAAAAATTAGCTGGGCGTG 0: 8
1: 66
2: 227
3: 440
4: 599
Right 1046534290 8:115488551-115488573 TGTAGTCCCAGCTACTCAAAAGG 0: 150
1: 4154
2: 56780
3: 180939
4: 229357
1046534285_1046534292 18 Left 1046534285 8:115488516-115488538 CCCCAAAAAATTAGCTGGGCGTG 0: 8
1: 66
2: 227
3: 440
4: 599
Right 1046534292 8:115488557-115488579 CCCAGCTACTCAAAAGGCTGAGG 0: 246
1: 8588
2: 114530
3: 217220
4: 237008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046534285 Original CRISPR CACGCCCAGCTAATTTTTTG GGG (reversed) Intronic
900182551 1:1318500-1318522 TACGCCCAGCTAATTTATTTTGG - Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
901123033 1:6910484-6910506 GAGGCTCAGCTCATTTTTTGAGG + Intronic
901282934 1:8053271-8053293 CACGCCTGGCTAATTTTTTGTGG - Intergenic
901299733 1:8190891-8190913 CATGCCCAGCTATTTTTTTTTGG + Intergenic
901487777 1:9577289-9577311 CACACCCGGCTAATTTTTGTAGG - Intronic
901515577 1:9743702-9743724 CATGCCCAGCTAATTTTCGTGGG + Intronic
901538581 1:9899915-9899937 CAGGCTCAGCTAATTTTTGTAGG - Intronic
901596414 1:10389010-10389032 CACGCCCAGCTAATTTTGGGGGG + Intergenic
901693480 1:10989609-10989631 CACACCTGGCTAATTTTTTTTGG - Intergenic
902029893 1:13414613-13414635 CACGCCCAGCTAATTTTTGTGGG + Intronic
902296095 1:15467933-15467955 CACACCTGGCTAATTTTTTTTGG - Intronic
902349348 1:15842008-15842030 CAGGCCCAGTTAATTGTTTTTGG - Intergenic
902648375 1:17819849-17819871 CACACCCAGCTAATTTTCCTAGG - Intronic
902795295 1:18796895-18796917 CACGCCTGGCTAATTTTTGTAGG - Intergenic
902894768 1:19471708-19471730 CACGCCTGGCTAATTTTTTTTGG - Intronic
903389025 1:22951160-22951182 CATGCCTGGCTAATTTTTTTTGG - Intergenic
903424183 1:23241090-23241112 CATGCCCAGCTAATTTTTGTGGG - Intergenic
903592546 1:24468156-24468178 CATGCCTGGCTAATTTTTTGTGG - Intronic
903700111 1:25240728-25240750 CGCACCTGGCTAATTTTTTGGGG - Intergenic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
903881948 1:26516550-26516572 GACGCCCAGCTAATTTTTGGTGG + Intergenic
903927477 1:26840964-26840986 CACATACAGCTAATTTTTTGGGG + Intronic
904154358 1:28470537-28470559 CATGCCCGGCTAATTTTTGGGGG - Intronic
904706954 1:32398298-32398320 CAGCCCTGGCTAATTTTTTGAGG + Intergenic
904711199 1:32431829-32431851 CATGCCCAGCTAATTTTTACAGG + Intergenic
904739784 1:32664740-32664762 CGTGCCCAGCCACTTTTTTGGGG + Intronic
904746383 1:32713803-32713825 TACGCCCGACTAATTTTTTTTGG + Intergenic
904776253 1:32908813-32908835 CACACCCAGCTAATTCGTGGGGG - Intergenic
905087941 1:35400356-35400378 CACGCCTGGCTAATTTTTATTGG + Intronic
905776635 1:40671917-40671939 CATGCCCAGCTAATTATTTTTGG + Intergenic
906104693 1:43284813-43284835 CACGCCCTCCTCAGTTTTTGGGG + Intronic
906261114 1:44391005-44391027 GATGCCCAGCTAATTTTTTTTGG + Intergenic
906283994 1:44573959-44573981 CACGCCCAGCTCATATTTTTTGG - Intronic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906412176 1:45587341-45587363 CACACCTGGCTAATTTTTTGGGG + Intronic
906420006 1:45657694-45657716 CATGCCCAGCTAACTTTTTTGGG - Intronic
906646532 1:47479119-47479141 CACGTCCGGCTAATTTTTTTTGG - Intergenic
907015731 1:51011088-51011110 CACGTCCAGCTAGTTTTTTTTGG - Intergenic
907182549 1:52583534-52583556 CACACCTGGCTAATTTTTTAAGG + Intergenic
907184363 1:52598518-52598540 CACGCACAGCTAAATTCTTTTGG - Intergenic
907199385 1:52713276-52713298 TATGCCTAGCTAGTTTTTTGTGG - Intergenic
907206454 1:52776060-52776082 CACGCCCGGCTAATTTTTTTGGG - Intronic
907254803 1:53170839-53170861 CACACCCAGCTAATTTTTGTGGG - Intergenic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907497821 1:54856442-54856464 CACGCCCGGCTAATTTTTTTTGG - Intronic
907507750 1:54933658-54933680 CACGCCTGGCTAATTTTTTGTGG + Intergenic
907923470 1:58934354-58934376 CACAGCTGGCTAATTTTTTGTGG + Intergenic
908469578 1:64430624-64430646 CATGCCCAGCTAATTTTTGTGGG + Intergenic
908955495 1:69621199-69621221 CATGCCCGGCTAATTTTTTATGG + Intronic
909018704 1:70407710-70407732 CATGCCAGGCTAATTTTTTGTGG - Intergenic
909710342 1:78642423-78642445 CATACCCAGCTAATTTTTGTGGG - Exonic
910006793 1:82407064-82407086 CATGCCCAGCTAATATTTTTTGG - Intergenic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
910477392 1:87621719-87621741 CACACCCGGCTAATTTTTGTGGG - Intergenic
910554941 1:88521199-88521221 CACACCTGGCTAATTTTTTTTGG + Intergenic
910862256 1:91753231-91753253 CATGACCAGCTGATTTTTTTTGG - Intronic
911186696 1:94911610-94911632 CATGCCCAGCTAATTTTTGTGGG - Intronic
911192460 1:94961322-94961344 CTCGCCAGGCTAACTTTTTGAGG - Intergenic
911442444 1:97944207-97944229 CACGCCCAGCTAATTTTTGTGGG + Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
912455706 1:109795583-109795605 CACGCCCGGCTAATTTTTTTTGG + Intergenic
912476832 1:109943508-109943530 CATGCCTGGCTAATTTTTTATGG + Intergenic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913019918 1:114778898-114778920 CACGCCCTGTTAATTTTTGTGGG - Intronic
913525074 1:119683488-119683510 CACGCCCAGCTAACTTTTTAAGG - Intronic
914326316 1:146620292-146620314 CACACCCAACTAATTTTTGTGGG - Intergenic
914687041 1:149989581-149989603 CATGCCCAGCTAATTTTTGTGGG - Intronic
914724808 1:150318629-150318651 CACGCCCGGCTAATTTTTTGTGG - Intergenic
914865003 1:151419510-151419532 TATGCCCAGCTAATTTTGGGGGG - Intronic
914904535 1:151732961-151732983 CACACCCAGCTAATTTTAGTGGG - Intergenic
914949457 1:152099794-152099816 CATGCCCAGGTAATTTTTTTTGG + Intergenic
915115560 1:153596938-153596960 CACGCCCGGCTAATTTTTGGGGG + Intergenic
915122671 1:153640613-153640635 CACGCCTGGCTTATTTTTGGTGG - Intronic
915261715 1:154681620-154681642 CACGCCCGCCTAATTTTTTTTGG - Intergenic
915307020 1:154986193-154986215 CACGCCTGGCTAATTTTTGTGGG + Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915477885 1:156163873-156163895 CAGGCCCAGCTCATTTTTTTTGG - Intronic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
917421149 1:174864958-174864980 CACATCCAGCTAATTTTTGTAGG - Intronic
917530934 1:175834328-175834350 CAGGCCCAGCTGATTTATTTTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918577788 1:186084626-186084648 CATGGCCAGCTTAATTTTTGTGG + Intronic
918590919 1:186240243-186240265 CATGCCTAGCTAATTTGGTGGGG + Intergenic
918777662 1:188655858-188655880 CAGGCCCAGCTAATTTTTGTGGG + Intergenic
918864944 1:189883186-189883208 CACGCCCGACTAATTTTTGTAGG + Intergenic
918978528 1:191524607-191524629 CACACCTCGCTAATTTTTTTTGG + Intergenic
919911825 1:202115951-202115973 CACACCCAGCTAAATTTTAGTGG + Intergenic
919998642 1:202777647-202777669 CACACTCAGCTAATTGTTTAAGG + Intronic
920045990 1:203132688-203132710 CACGCCCAGCTATTTGTTTTTGG - Intronic
920148039 1:203879755-203879777 CATGCCCGGCTAATTTTTTACGG - Intergenic
920332882 1:205223822-205223844 CAAGCCTGACTAATTTTTTGCGG - Intergenic
920391687 1:205607460-205607482 CACGTCCAGCTAATTTTGGGAGG + Intronic
920521081 1:206626967-206626989 AACGCACAGCTCTTTTTTTGGGG - Intergenic
920579989 1:207097367-207097389 CACGCTTGGCTAATTTTTTAAGG + Intronic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
920982397 1:210850352-210850374 CACGCCCAGCTACTTTTTTTTGG - Intronic
921099332 1:211914847-211914869 CACGCCCAGCCTTTTTTTTAGGG + Intergenic
921203958 1:212832173-212832195 CATGCCCAGCTAATTTTTGTGGG + Intronic
921490574 1:215770968-215770990 CACGCCTGGCTAATTTTTGTAGG - Intronic
921541001 1:216415675-216415697 CACACCTGGCTAATTTTTTTAGG + Intronic
921996375 1:221423850-221423872 CACTCCCAACTAGTTTTATGAGG + Intergenic
922320961 1:224486260-224486282 CATGCCCAGCTAATTTTTGTGGG + Intronic
922344942 1:224688766-224688788 CACGCCCGACTAATTTGTGGGGG - Intronic
922498302 1:226077970-226077992 CACGCCCAGCTAATTTTTGTGGG + Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
922708116 1:227802109-227802131 CACGCCCAGCTAACTTTTTTGGG + Intergenic
922782818 1:228267061-228267083 CATGCCTAGCTAATTTTTTAAGG + Intronic
923250567 1:232176422-232176444 CACACCCAGCTAATTTTTAAAGG - Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923713368 1:236404644-236404666 CATGCCCAGCTAATGTATGGGGG - Intronic
923785577 1:237065434-237065456 CACGCCTGGCTAATTTTTTTTGG + Intronic
923812673 1:237337093-237337115 CACGTCTGGCTAATTTTTTGTGG - Intronic
923928547 1:238664724-238664746 CATACCCAGCTAATATTTTTTGG - Intergenic
924069491 1:240261759-240261781 CACACACAGGTAATTATTTGGGG - Intronic
924635621 1:245785004-245785026 CGTGCCCAGCTAATTGTTTTGGG + Intronic
924763868 1:247013271-247013293 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1063315873 10:5005524-5005546 CACGTCCATCTATTTTTTTTTGG - Intronic
1063672668 10:8112061-8112083 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1063957665 10:11281594-11281616 CACACCCAGCTAACTTTTGTAGG - Intronic
1063992533 10:11581927-11581949 CACGCCGGGCTAATTTTTGGTGG + Intronic
1064039523 10:11947628-11947650 CATGCCCAGCTAATTATTTTGGG - Intronic
1064053498 10:12078453-12078475 CATGCCCGGCTAATTTTTGTGGG - Intronic
1064203611 10:13304353-13304375 CACGCTCAGCTAATTTTCTGGGG - Intergenic
1064628909 10:17289336-17289358 CCCTGCCACCTAATTTTTTGAGG + Intergenic
1064661538 10:17612763-17612785 CACGCCCGGCTAATTTTTTTTGG - Intronic
1064714841 10:18166410-18166432 CATGTCCAGCTAATTTTTGTTGG + Intronic
1064759324 10:18602217-18602239 CACACCCAGCTAATTTTTGTGGG + Intronic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065374226 10:25020608-25020630 CACACCCAGCTAATTTTTGTAGG - Intronic
1065545485 10:26815752-26815774 CATACCCAGCTAATTTTTTTGGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1065567842 10:27032916-27032938 CACACCTGGCTAATTTTTTGTGG - Intronic
1065791107 10:29261840-29261862 CACACCCAGCTAATTTGATGAGG + Intergenic
1065798050 10:29325006-29325028 CATGCCTAGCTAATTTTTTTTGG - Intergenic
1066207945 10:33208215-33208237 CACGCCGAGCTAATTTTTTGTGG + Intronic
1066236608 10:33490966-33490988 CACTCCCGGCTAATTTTTTATGG - Intergenic
1066251873 10:33641105-33641127 CGAGCCCGGCTAATTTTTTGGGG - Intergenic
1066373807 10:34839454-34839476 CATGCCTAGTTAATTTTTTGTGG + Intergenic
1067379337 10:45758762-45758784 CATGCCCGGCTAATTTTTTGTGG + Intronic
1067887037 10:50099424-50099446 CATGCCCGGCTAATTTTTTGTGG + Intronic
1068071046 10:52196167-52196189 CACGCCTGGCTAATTTTTTTTGG + Intronic
1068563430 10:58543664-58543686 TAGGCTCAGCTAATTTTTTTAGG + Intronic
1068740605 10:60465098-60465120 TAGGCCCAGCTAATTTTTGTGGG - Intronic
1069662649 10:70133614-70133636 CAAGCCCGGCTAATTTTTGTAGG - Intergenic
1070134511 10:73680572-73680594 TATGCCCAGATAATTTTTTTTGG + Intronic
1070324800 10:75381377-75381399 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1070431499 10:76343972-76343994 CACGCCTGGCTAATTTTTTTTGG + Intronic
1070620406 10:78005320-78005342 CATGCCCGGCTAATTTTTTAAGG - Intronic
1070995396 10:80774650-80774672 CATGCCCAGTTAATTTTTGTGGG - Intergenic
1071331851 10:84568428-84568450 CTGGCCCATCTATTTTTTTGAGG + Intergenic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1071618599 10:87097433-87097455 CACGCCTGGCTAATTTTTGTAGG - Intronic
1071948629 10:90677405-90677427 CATGCCTGGCTAATTTTTTGTGG + Intergenic
1072042525 10:91622284-91622306 GACACCCAGCTAATTTTTGTGGG + Intergenic
1072070497 10:91910561-91910583 AACACCCAGCTAATTTTTAGTGG + Intergenic
1072115077 10:92363021-92363043 CATGTCCAGCTAATTTTTTTTGG - Intergenic
1072153719 10:92704712-92704734 CATGCCTAGCTAATTTTTAGGGG - Intergenic
1072155971 10:92723955-92723977 CACACCTGGCTAATTTTTTCAGG - Intergenic
1072162852 10:92784471-92784493 CATGCCCAACTAATTTTTGTGGG + Intergenic
1072315779 10:94201630-94201652 CAAGCCCGGCTAATTTTTTTTGG + Intronic
1072575776 10:96699025-96699047 CACGCCTGGCTAATTTTGTGGGG - Intronic
1072704766 10:97673141-97673163 CACGGTCGGCTAATTTTTTTTGG + Intronic
1072902902 10:99425289-99425311 CACTCCCAGCTAATCCTTAGTGG - Intronic
1072919261 10:99562110-99562132 CATGCCGAGATAATTTTTCGGGG + Intergenic
1072952725 10:99861938-99861960 TATGCCCAGCTAATTTTTGTGGG + Intergenic
1073010448 10:100355085-100355107 CATGCCTGGCTAATTTTTTGTGG + Intronic
1073231313 10:101973203-101973225 CAGGCCTGGCTAATTTTTTTTGG - Intronic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1073330008 10:102664181-102664203 CACGCCCGGCTAATTTTGCCCGG + Intergenic
1073589195 10:104740005-104740027 AAAGACCAGCTAATATTTTGTGG - Intronic
1073756350 10:106585065-106585087 CATGCCTGGCTAATTTTTTTTGG - Intronic
1074157150 10:110809057-110809079 CACACCAGGCTAATTTTTTTAGG - Intronic
1074505606 10:114067722-114067744 CATGCCCAGCCTTTTTTTTGAGG + Intergenic
1074770094 10:116727912-116727934 CATGCCCGACTAATTTTTTTGGG + Intronic
1075135091 10:119777367-119777389 CACGCCTGGCTAATTTTTGTGGG - Intronic
1075253385 10:120903351-120903373 CACACCCAGCTAATTTTCAAGGG - Intronic
1075275349 10:121088062-121088084 CACACACAGCTATTTGTTTGAGG + Intergenic
1075468167 10:122667580-122667602 CACGCCCAGCTAATGATAGGTGG + Intergenic
1075680500 10:124327628-124327650 CATGCCTGGTTAATTTTTTGTGG - Intergenic
1075703016 10:124481531-124481553 CACACCTGGCTAATTTTTTTTGG + Intronic
1075774343 10:124970414-124970436 AATGCCTAGCTAATATTTTGGGG + Intronic
1075878935 10:125832963-125832985 CATACCCGGCTAATTTTTTGTGG - Intronic
1076042706 10:127264815-127264837 CGTGCCCAGCTAATTTTTTGTGG + Intronic
1076456079 10:130597681-130597703 CGCGCCCGGCTAATTTTTTTTGG + Intergenic
1077054311 11:583358-583380 CACGCCCGGCTAATTTTGGTGGG - Intronic
1077611093 11:3643358-3643380 CACGCCCGGCTAATCTTTGTTGG - Intergenic
1077867095 11:6231625-6231647 CACACCTGGCTAATTTTTGGTGG + Intronic
1078086504 11:8236345-8236367 CAAGCCAGGCTAATTTTTGGGGG + Intronic
1078184269 11:9038483-9038505 CACGCTCAGCTAACTTTTTAAGG - Intronic
1078692979 11:13600657-13600679 CATGACAGGCTAATTTTTTGTGG + Intergenic
1078789679 11:14529797-14529819 CACTCCCAGCTTTTTTTCTGTGG + Intronic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1079291777 11:19194520-19194542 CACACCAGGGTAATTTTTTGGGG - Intronic
1079424016 11:20323304-20323326 TGCACCTAGCTAATTTTTTGTGG - Intergenic
1079596270 11:22251871-22251893 CACGCCTGGCTAATTTTTTTTGG - Intronic
1080191882 11:29560267-29560289 CACGCCCAGCTACTTTTTTGGGG - Intergenic
1080536905 11:33230706-33230728 CACGCCCGGCTAATTTTCTTGGG + Intergenic
1080725371 11:34894490-34894512 CACGCCTGGCTAATTTTTTCTGG - Intronic
1080905461 11:36540559-36540581 CACGCATGGCTAATTTTTTTTGG + Intronic
1081116094 11:39203395-39203417 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1081162249 11:39763656-39763678 CACGCCCGGCTTATTTTTTTTGG - Intergenic
1081163725 11:39784391-39784413 CACGCCCTGCTAATTTTTTTTGG + Intergenic
1081170911 11:39869159-39869181 CATGCCCAGCTAAGTTTTGTGGG - Intergenic
1081443632 11:43107981-43108003 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1081486671 11:43536036-43536058 CACGTCCAGCTAATTTTTTTTGG + Intergenic
1082951768 11:58824005-58824027 CATGCTCAGCTAATTTGTGGTGG - Intergenic
1083648047 11:64184544-64184566 TACGCCTAGCTAATTTTTCTGGG - Intergenic
1083791046 11:64986130-64986152 CACTCCCATCTATTTGTTTGAGG + Intergenic
1083825235 11:65198814-65198836 CATGCCCAGATAATTTTTTTTGG + Intronic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1083916869 11:65752066-65752088 CATACCCAGCTAATTTTTTTTGG + Intergenic
1083942461 11:65903841-65903863 TACGCCCAGCTAATTTTTTTTGG + Intergenic
1084156537 11:67316251-67316273 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1084167379 11:67381989-67382011 CATGCCTGGCTAATTTTTTGGGG - Intronic
1084239874 11:67811751-67811773 TACATCCAGCTAATTTATTGTGG + Intergenic
1084318907 11:68362532-68362554 CACACCCAGCTAATTTTTGGGGG - Intronic
1084365805 11:68697392-68697414 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1084615744 11:70234692-70234714 CACACCCAGCTAATTTTGATGGG + Intergenic
1084777303 11:71385982-71386004 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1084842965 11:71872569-71872591 CACGCCCAGCTATTTTTTTTTGG - Intronic
1085211704 11:74786387-74786409 CATGCCCTGCTAATTGTTGGGGG + Intronic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085378002 11:76084905-76084927 CATGCCTGGCTAATTTTTGGGGG - Intronic
1085927909 11:81044046-81044068 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1086083585 11:82931506-82931528 CATGCCCAGCTAATTTTTGTGGG + Intronic
1086245821 11:84751468-84751490 CACTCCAAGCTACTTTTTTTTGG - Intronic
1086420777 11:86635132-86635154 CACGCCTGGCTAATTTTTGTAGG - Intronic
1087717205 11:101622117-101622139 CATGCCCAGATAATTTTTTTTGG - Intronic
1087758033 11:102074857-102074879 CACGTCCAGCTTATTTTGGGGGG + Intronic
1087818726 11:102687869-102687891 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1088467946 11:110161975-110161997 TATGCCCAGCTAATTTTTTTTGG - Intronic
1088529414 11:110792690-110792712 TACGTCCAGCTAATTTTTGTGGG + Intergenic
1089028403 11:115296105-115296127 CATGCCCAGCTAATATTTTTTGG + Intronic
1089193640 11:116677241-116677263 CACACCCAGCTAAATTTTTTTGG - Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1089722382 11:120439007-120439029 CACGCCTGGCTAATTTATTTTGG + Intronic
1089898455 11:121956222-121956244 CATGCCCGGCTAATTTCTTCCGG - Intergenic
1090300607 11:125634477-125634499 CACACCTGGCTAATTTGTTGTGG + Intronic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1090819350 11:130327098-130327120 CATGCCCAGCCAATTTATTGTGG + Intergenic
1090958064 11:131531293-131531315 CATGCTCTGCTAATTTTTTTTGG + Intronic
1091031292 11:132190578-132190600 CGCGGCCAGCTAATTTTTGTAGG - Intronic
1091079011 11:132648656-132648678 CATGCCCAGCTAATTTTTTCTGG + Intronic
1092124966 12:6068624-6068646 CATGCCCAGCTAATTTCTGTGGG + Intronic
1092188456 12:6499366-6499388 CACGCCTGGCTAATTCTTGGGGG + Intronic
1092233558 12:6791723-6791745 CATGCCCAGCTAACTTTTGTGGG - Intronic
1092782425 12:11999470-11999492 CATGTCCAGCTAATTTTTGTAGG + Intergenic
1093406327 12:18809492-18809514 CACGCCCGGCTAATTTTTTGTGG + Intergenic
1093454989 12:19356360-19356382 CATGCCTGGCTAATTTTTTTTGG - Intronic
1094106289 12:26815172-26815194 CATGCCTGGCTAATTTTTGGTGG - Intronic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1094383115 12:29865231-29865253 CACGCCCGGCCTATTTTTTAAGG - Intergenic
1094538750 12:31345307-31345329 CACGCCCAGCTAATTTTTCTGGG + Intergenic
1094644948 12:32313822-32313844 CGTGCCCAGCTAATTTTTTCTGG - Intronic
1094646465 12:32329259-32329281 CATGCCTGGCTAACTTTTTGTGG + Intronic
1095156162 12:38857737-38857759 CATGCCCGGCTATTTTTTTTGGG - Intronic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1095961536 12:47837880-47837902 CACTCCAGGCTGATTTTTTGGGG - Intergenic
1096246989 12:49996478-49996500 CATGCCCGGCTAATTTTTTTTGG - Intronic
1096308497 12:50499888-50499910 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1096315321 12:50559574-50559596 CACACCTGGCTAATTTTTTGTGG - Intronic
1096467792 12:51856968-51856990 CACGCTCAACTAATTTTTGTAGG + Intergenic
1096722104 12:53530898-53530920 CTCACCCAGCCTATTTTTTGAGG + Intronic
1097099826 12:56579474-56579496 CACACCCGGCTAATTTTTTTTGG - Intronic
1097220280 12:57445899-57445921 CATGCCTGGCTAATTTTTGGTGG + Intronic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1098044083 12:66382080-66382102 CATGCCCAGCTAATTTTGAGGGG - Intronic
1098414785 12:70220542-70220564 CATGCCCAGCTAATTTTTGTTGG + Intergenic
1098543951 12:71690304-71690326 CATGCCCAGCTAATTTTTTCTGG + Intronic
1099150179 12:79101627-79101649 CACACCAAGCTTATTTATTGAGG - Intronic
1099908401 12:88799600-88799622 CACAGCCAGCTAATTTTTCTGGG + Intergenic
1100069474 12:90694548-90694570 CATGCCCGGCTAATTTTTTTTGG + Intergenic
1100302217 12:93318342-93318364 CATGCCTGGCTAATTTTTTTGGG - Intergenic
1100315232 12:93439319-93439341 CACACCCAGCTAATTTTTGTAGG - Intronic
1100534351 12:95492719-95492741 AACGCCCAGCTAATTTTTTTTGG + Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101844737 12:108353774-108353796 CATGCCCAGTTAATTTTTTATGG + Intergenic
1101905496 12:108822180-108822202 CACAGCCAGCTAGTTTTTTGTGG - Intronic
1102115818 12:110402484-110402506 CACGCCTGGCTAAATTTTTTTGG + Intronic
1102118429 12:110421359-110421381 CACGCCTGGCTAATTTTTTTTGG + Intergenic
1102286115 12:111658093-111658115 CACGCCCAGCTAATTTTAGTAGG + Intronic
1102327950 12:112004769-112004791 CATGTCCAGCTATTTTTATGGGG + Intronic
1102450067 12:113035292-113035314 CATGCCTAGCTAATTTTTGTAGG - Intergenic
1103076729 12:117989346-117989368 CATGCCTGGCTAGTTTTTTGTGG + Intergenic
1103440298 12:120958008-120958030 CACACCCTGCTAAATTTTTTTGG + Intergenic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1103513096 12:121488776-121488798 CAGGCCTGGCTAATTTTTTTTGG + Intronic
1103774403 12:123355624-123355646 TGCACCCAGCTAATTTTTTGAGG - Intronic
1103787520 12:123444272-123444294 CACGCCTGGCTAATTTTCGGGGG - Intergenic
1103865812 12:124051166-124051188 CACGCCCAGCCAATTTTTGTGGG - Intronic
1104617922 12:130285766-130285788 CACACCTGGCTAATTTTTTTTGG - Intergenic
1104913677 12:132252724-132252746 CACGCCTGGCTAATTTTTTTTGG - Intronic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1105063356 12:133173792-133173814 CACGCCTGGTTAATATTTTGTGG + Intronic
1105288614 13:19029939-19029961 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1105438596 13:20397771-20397793 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1105464049 13:20620720-20620742 CACGCCTGGCTAATTTTTTGTGG + Intronic
1105483877 13:20806707-20806729 CACATCCAGCTAATTTTTGCAGG + Intronic
1105493010 13:20905754-20905776 CTCGCCTGGCTAATTTTTAGTGG - Intergenic
1105777734 13:23678609-23678631 CACACCCGGCTAATTTTTGTGGG + Intergenic
1106151945 13:27113076-27113098 CATGCTCAGCTAATTTTTTAAGG - Intronic
1107460043 13:40593178-40593200 CACGCCTGGCTAATTTTTGTTGG + Intronic
1107479762 13:40776368-40776390 CATACCCAGCTAACTTTTTTTGG - Intergenic
1107484127 13:40810313-40810335 CATGTCCAGCTAATTTTTTTTGG + Intergenic
1107570740 13:41655378-41655400 CACGCCCAGCCAGTATTTAGAGG + Intronic
1108042992 13:46356860-46356882 CATGCCCAGCTAGCTTTTTTTGG + Intronic
1108405849 13:50100754-50100776 CACACTTGGCTAATTTTTTGTGG - Intronic
1108415695 13:50196260-50196282 CATGCCGGGCTAATTTTTTTTGG + Intronic
1109408854 13:61938181-61938203 CATGCCCAGCTAATTTTTGGGGG + Intergenic
1109739379 13:66532145-66532167 CATGTCCAGCTATTTTTTAGTGG + Intronic
1109861185 13:68201274-68201296 CACACCTGGCTAATTTTTTTTGG - Intergenic
1109988902 13:70027859-70027881 CATGCACAGTTAATTTTTAGAGG + Intronic
1109991129 13:70059312-70059334 TATGCCCAGCTAATTGTTTTTGG + Intronic
1110584687 13:77175083-77175105 CACACTCAGTTAATTTTTTAGGG + Intronic
1111024942 13:82508984-82509006 CACACCTGGCTAATTTTTTGTGG - Intergenic
1111453754 13:88453078-88453100 CACACCCGGCTAATTTTTTTTGG + Intergenic
1111925484 13:94459031-94459053 CATGCCCAGCTAATTTGTAAAGG + Intronic
1111961890 13:94820602-94820624 CAAGTTCAGATAATTTTTTGAGG - Intergenic
1111984154 13:95049040-95049062 CACACCCTGCTCGTTTTTTGGGG - Intronic
1112011257 13:95295663-95295685 GACACCTAGCTAATTTTTTGAGG - Intronic
1112026053 13:95412116-95412138 CACGACTGGCTAATTTTTTTAGG - Intergenic
1112287672 13:98118441-98118463 CAAGCCCAGCTAATTTTTAGTGG + Intergenic
1112522130 13:100105683-100105705 CACACCCAGCTAATTTTTGTGGG - Intronic
1112748163 13:102551583-102551605 CAAGCCCGGCTAATTTTTTTTGG - Intergenic
1113626272 13:111850186-111850208 TATGCCTGGCTAATTTTTTGTGG - Intergenic
1113840726 13:113359426-113359448 CATGCCCAGCTAATTTTTAAGGG - Intronic
1114038672 14:18655376-18655398 CACGCCCCACTAATTTTTGTAGG + Intergenic
1114119945 14:19659671-19659693 CACGCCCCACTAATTTTTGTAGG - Intergenic
1114541469 14:23463285-23463307 CACGCCCAACTAATTTTTGTGGG - Intergenic
1114667426 14:24387652-24387674 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1115242464 14:31263263-31263285 CATGCCCGGCTAATTTTTGCGGG + Intergenic
1115816612 14:37170791-37170813 CATGCCCGGCTAGTTTTTTGGGG - Intronic
1115838623 14:37439995-37440017 CATGCCTGGCTAATTTGTTGGGG + Intronic
1116458884 14:45147904-45147926 CACGCCCGGCTTTTTTTTTGGGG - Intronic
1116742227 14:48770954-48770976 CATGCCCAGCTAATTTTTGTAGG - Intergenic
1116815065 14:49576238-49576260 CACGCCTGGCTAATTGTTTTTGG + Exonic
1116920320 14:50565326-50565348 CATGCCCAGCTAATTTGGGGTGG - Intronic
1116989677 14:51262162-51262184 CATGCCCAGCTAAATTTTGGGGG + Intergenic
1117151481 14:52892609-52892631 CACGTCCAGCTAATTTTTTTTGG + Intronic
1117362956 14:54996441-54996463 CATGCCTGGCTAATTTTTTGTGG - Intronic
1117421627 14:55552245-55552267 CACGCCCGGCTAACTTTTTGTGG + Intergenic
1117682257 14:58216279-58216301 CACACCCAGCTAATTTTTGGGGG + Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118224151 14:63883504-63883526 CACGCCTGGCTAACTTTTTTTGG + Intronic
1118358731 14:65037934-65037956 GACACCCAGCTAATTTTTACGGG + Intronic
1118387263 14:65266230-65266252 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1118851882 14:69590363-69590385 CATGCCCAGCTAAATTTTGTGGG + Intergenic
1119096189 14:71833843-71833865 CAAACCCAGCTAAGTTTTGGGGG - Intergenic
1119281335 14:73411186-73411208 CATGACCGGCTAATTTTTGGGGG + Intronic
1119346864 14:73932778-73932800 CCAGTCCAGCTAACTTTTTGTGG + Exonic
1119452048 14:74719983-74720005 CACGCCCGGCTAATTTTTTTTGG - Intronic
1120167527 14:81217633-81217655 CACTCCTGGCTAATTTTTTGTGG - Intronic
1120416608 14:84226811-84226833 CAAGCTCATCTAATTTTATGTGG - Intergenic
1121091902 14:91188671-91188693 CACAGCCCGCTAATTTTTTTTGG - Intronic
1121202278 14:92128324-92128346 CACGCCCAGCTAATTCTTTTTGG - Intronic
1121341108 14:93105679-93105701 CACGCCTGGCTAATTTTTGTGGG + Intronic
1122484658 14:102070714-102070736 CACCCCCTGCTTATTTTGTGCGG - Intergenic
1123457588 15:20439882-20439904 CAAGCCCGGCTCATTTTTTTTGG + Intergenic
1123479303 15:20616224-20616246 CAGGGCCAGCTAATTCTTAGAGG - Intergenic
1123638710 15:22384161-22384183 CAGGGCCAGCTAATTCTTAGAGG + Intergenic
1123660483 15:22560540-22560562 CAAGCCCGGCTCATTTTTTTTGG - Intergenic
1123714886 15:23020427-23020449 CATGCCCGGCTAATTTTTTGGGG - Intronic
1123752889 15:23372478-23372500 CAGGCCCAGCTAATCTTTGTGGG + Intergenic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1124314337 15:28655025-28655047 CAAGCCCGGCTCATTTTTTTTGG - Intergenic
1124407864 15:29407820-29407842 CACACCCCACTAATTTTTTGGGG + Intronic
1124477733 15:30049507-30049529 CACACCCAGCAAATTTTTTTTGG + Intergenic
1124610286 15:31203376-31203398 CATGCCCAGCCCATATTTTGGGG - Intergenic
1125159991 15:36631985-36632007 CACGCCCAGCTAGCTTTTTAAGG + Intronic
1125470798 15:40001471-40001493 CACGCACGGCTAATTTTTGTAGG - Intronic
1125557969 15:40601996-40602018 CACGCCTGGCTAATTTTTGTGGG + Intronic
1125559028 15:40612332-40612354 CATACCTGGCTAATTTTTTGGGG - Intronic
1125624272 15:41093689-41093711 CACGTTCAACTAATTTTTGGGGG - Intronic
1125653155 15:41333733-41333755 CACGCCCGGCTAATTTTTTAAGG - Intronic
1125702876 15:41703962-41703984 CACACCTGGCTAATTTTTTTTGG + Intronic
1126622584 15:50654842-50654864 CACACCCGGGTAGTTTTTTGTGG - Intronic
1126735727 15:51730357-51730379 CACACCCAGCTAAATGTTTTGGG - Intronic
1127656545 15:61061194-61061216 CATGCCCGGCTAATGTTTTGTGG - Intronic
1127696011 15:61448571-61448593 CATGCCCAACTAATTTTTGTAGG + Intergenic
1128058100 15:64715650-64715672 CACGCCTGGCTAATTTTTGGTGG - Intergenic
1128064799 15:64757817-64757839 CACGCCTGGCTGATTTTTTGTGG - Intronic
1128315447 15:66656664-66656686 CACGCCCAGATAATCTTTGTGGG + Intronic
1128747475 15:70124657-70124679 GACACCCAGCTAATTTTTGTGGG - Intergenic
1128907687 15:71482740-71482762 CACACACGGCTAATATTTTGTGG + Intronic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1129281052 15:74485294-74485316 CACGCCCAGCTAGGTTTTTTTGG + Intergenic
1129870400 15:78936601-78936623 CACGTCCAGCGTATTTTCTGAGG - Intronic
1130138956 15:81207077-81207099 CACGCCTGGCTAATTTTTTGTGG - Intronic
1131104604 15:89724043-89724065 CACGCCCAGCTATTTTTTTTTGG - Intronic
1131694858 15:94865436-94865458 AAATCTCAGCTAATTTTTTGAGG - Intergenic
1132173516 15:99688598-99688620 CACGCCCGGCTAATTTTTTGTGG - Intronic
1132361480 15:101219921-101219943 CACGCCCGGCTAATTTTGTGAGG + Intronic
1132824186 16:1894927-1894949 CACGCCCAGCTAATTGTTTTTGG + Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133074820 16:3271800-3271822 CATGGCCAGTTAATTTTGTGAGG - Intronic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1133902775 16:9993071-9993093 CATACCTGGCTAATTTTTTGGGG - Intronic
1134087522 16:11368309-11368331 GACACCCAGCTAATTTTTTTTGG + Intronic
1134133282 16:11664103-11664125 CACGCCTAGCTAAATTTTTTTGG - Intergenic
1134240951 16:12506307-12506329 CAAGCCCAGCTTTTTTTTTAGGG - Intronic
1134338830 16:13326562-13326584 TACGCCCAGCTAAGTTTTGTAGG - Intergenic
1134396677 16:13871464-13871486 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134440595 16:14297514-14297536 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134492462 16:14705208-14705230 CACGCCCAGCTAACTGGTGGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1134497843 16:14744330-14744352 CACGCCCAGCTAACTGGTGGTGG - Intronic
1135030880 16:19037624-19037646 CACACCCAGCTAATTCTTCTGGG + Intronic
1135077000 16:19402381-19402403 CACGCATGGCTAATTTTTTGAGG + Intergenic
1135169952 16:20175025-20175047 CACGCCCAGCTAATTTGTGTAGG - Intergenic
1135493418 16:22930567-22930589 CAAACTCAGCTAATTTTGTGGGG - Intergenic
1135861856 16:26063538-26063560 CACACCTAGCTAATTTTTAATGG - Intronic
1136129317 16:28209970-28209992 CATGCCTGGCTAATTTTTTGTGG - Intronic
1136319718 16:29476019-29476041 CACGCCCAGCTAACTGGTGGTGG + Intergenic
1136353265 16:29726116-29726138 CACGCCCAGCCTATATTTTGAGG + Intergenic
1136430016 16:30191608-30191630 CATGCCCAGCTAATTTTTGGGGG - Intergenic
1136434289 16:30215364-30215386 CACGCCCAGCTAACTGGTGGTGG + Intergenic
1137246758 16:46712145-46712167 AATGCCCAACTAATTTTTTTTGG + Intronic
1137416125 16:48282252-48282274 CATGCCCAGCTAATTTTTGTGGG - Intronic
1137582969 16:49645351-49645373 CAAGCCCAGCTAATTGGTAGTGG + Intronic
1137827703 16:51513743-51513765 CACGTCTGGCTAATTTTTTTTGG + Intergenic
1137900220 16:52259712-52259734 CACTCCTGGCTAATTTTTTTGGG + Intergenic
1137998602 16:53248680-53248702 CACACCCAGCTAATTTATTTTGG + Intronic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1139508890 16:67415300-67415322 CACGCTCAGCTAATTTTTTAAGG - Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1139571739 16:67817120-67817142 CACACCTGGCTAATTTTTTGCGG + Intronic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139609655 16:68046532-68046554 CACGCTCGGCTAATTTTTGTTGG + Intronic
1139626493 16:68193510-68193532 CACACCCAGCTAATTTTTGTAGG - Intronic
1139697684 16:68686809-68686831 CACACCCAGCTTATTTTTTTTGG - Intronic
1139735004 16:68979998-68980020 CATGCCCGGCTAATTTTTTTTGG + Intronic
1139806710 16:69571914-69571936 CACGCCCGGCTAATTTTTTTTGG + Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1139821806 16:69726814-69726836 CACCCCCAGCCAGATTTTTGAGG - Exonic
1140007251 16:71090654-71090676 CACACCCAACTAATTTTTGTGGG + Intronic
1140047362 16:71450560-71450582 CACACCCGGCTAATTTTTTGTGG - Intronic
1140217260 16:73018448-73018470 AATGCCCAGGTAATTTTTTGTGG - Intronic
1140525292 16:75617938-75617960 CACACCCAGCTAACTTTTCCTGG - Intronic
1140736525 16:77902814-77902836 CATTCCCAGCTAGGTTTTTGTGG - Intronic
1140785382 16:78336348-78336370 CACACCTGGCTAATTTGTTGTGG - Intronic
1140816528 16:78626285-78626307 CACGCTCAGCTAATTTTTGCAGG + Intronic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1140913141 16:79471518-79471540 CATGCCCAACTAATTTTTGTGGG - Intergenic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1141417729 16:83889514-83889536 CATGCCCAGCTAATTTTTATGGG + Intergenic
1141440774 16:84028426-84028448 CATGCCTGGCTAATTTTTTTTGG - Intronic
1141542513 16:84736943-84736965 CTCGCCCGGCTAATTTTTTGTGG + Intronic
1141569159 16:84923762-84923784 CAGGCCTGGCTAATTTTTTTTGG - Intergenic
1142339409 16:89510987-89511009 AGCGCCTAGCTAATTTTTGGGGG + Intronic
1142536138 17:618605-618627 CATGCCCAGCTAATATTTCCCGG + Intronic
1142536224 17:619036-619058 CACGCCCCGCTAATATTTCCCGG + Intronic
1142536236 17:619086-619108 CACGCCCAGCTAATATTTCCCGG + Intronic
1142536282 17:619326-619348 CACGCCCCGCTAATATTTCCCGG + Intronic
1142536386 17:619775-619797 CACGCCCCGCTAATATTTCCCGG + Intronic
1142536398 17:619825-619847 CACGCCCCGCTAATATTTCCCGG + Intronic
1142536410 17:619875-619897 CACGCCCCGCTAATATTTCCCGG + Intronic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1142905424 17:3038080-3038102 CCTGCCCAGCTAATTTTTTAGGG - Intergenic
1143227308 17:5317059-5317081 CATGCCTGGCTAATTTTTGGAGG + Intronic
1143634698 17:8157776-8157798 CATGCCCGGCTAATTTTTGTAGG - Intronic
1143649957 17:8257263-8257285 CACGCCCAGCCAAGTTTCTCAGG - Intronic
1143819451 17:9547945-9547967 CACACCCAGCTAATTTTTGTGGG + Intronic
1143978207 17:10845812-10845834 CATGCCTGGCTAATTTTGTGGGG - Intergenic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1144865599 17:18333620-18333642 CATGTCCAGCTAATTTTTGTTGG + Intronic
1145237550 17:21219461-21219483 CATGCCCAGCTAACTTTTTTTGG - Intergenic
1145716509 17:27028220-27028242 CATACCCAGCTAATTTTTGTGGG - Intergenic
1145873263 17:28294321-28294343 CATGCCCAACTAATTTTGGGGGG + Intergenic
1145915164 17:28569311-28569333 CACACCCAGCTGATTTGTTTTGG - Intronic
1145952298 17:28828410-28828432 CATGCCTGGCTAATTTTTTGTGG - Intronic
1146053031 17:29567522-29567544 CCCGCCCAGCCAAGTTATTGCGG - Intronic
1146206502 17:30909483-30909505 TATGCCCAGCTAATTTTTTTTGG - Intronic
1146373200 17:32278004-32278026 CACACCCAGCTGATTTTTAAGGG - Intronic
1146407035 17:32547791-32547813 CACGCCCGGCTAATTTTTGTAGG - Intronic
1146921723 17:36717257-36717279 CACGCCTGGCTAATTTTTGTGGG + Intergenic
1146999393 17:37350361-37350383 CACACCCAGCTAATTTTTTCTGG - Intronic
1147028740 17:37612223-37612245 CACACCCGGCTAACTTTTTTTGG + Exonic
1147112392 17:38272804-38272826 CACTCGCGGCTAATTTTGTGGGG + Intergenic
1147499465 17:40948848-40948870 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1147601015 17:41745538-41745560 CACGCCTGGCTAATTTTTGTGGG - Intergenic
1147610701 17:41800414-41800436 CACACCTGGCTAATTTTTTGGGG - Intergenic
1147719506 17:42530042-42530064 CATGCCCGGCTAATTTTTGCAGG - Intergenic
1147801679 17:43095423-43095445 CACACCCGGTTAATTTTTTGTGG - Intronic
1147869308 17:43576459-43576481 CATGCCCTGCTAATTTTTGCAGG + Intronic
1148002026 17:44394397-44394419 TACGCCCGGCTAATTTTTGTAGG + Intergenic
1148004709 17:44417369-44417391 CACATCCAGCTAATTTTTGGGGG + Intronic
1148009184 17:44461845-44461867 CAAGCCCAACTAATTTTTGGGGG + Intronic
1148220374 17:45857336-45857358 CATGTCCAGCCAATTTTCTGGGG + Intergenic
1148432841 17:47656389-47656411 CACACCCAGCTAACTTTTTTGGG - Intronic
1148832273 17:50441325-50441347 CACACCCAGCTAAATTTTTTTGG + Intronic
1148910229 17:50938592-50938614 CACGCCTGGCTAATTTTTGGGGG + Intergenic
1149483079 17:57018962-57018984 CACGCCCGGCTAATATTTTGAGG + Intergenic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149674733 17:58449541-58449563 CACACCCAGCTAATTTTTGCAGG - Intronic
1149676794 17:58472008-58472030 CATGCCTGGCTAATTTTTTTTGG + Intronic
1149724603 17:58880778-58880800 CACTGCTAGCTAATTTTTTTTGG + Intronic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1149790770 17:59474917-59474939 CATGCCCAGCTAATTTTTCTGGG + Intergenic
1150093508 17:62351579-62351601 CACACCCAGCTAATTTTTGTGGG + Intergenic
1150349246 17:64430023-64430045 CACACCCAACTAATTTTTGTGGG + Intergenic
1150555676 17:66252095-66252117 CATGCCCAGCTAATTTTTGTAGG - Intronic
1150743006 17:67794763-67794785 CCCGCCCAGCTGATTTTTTTTGG - Intergenic
1150779441 17:68108808-68108830 GACTCCCAGCTAATTTTTTTGGG + Intergenic
1151088567 17:71409018-71409040 CACGCCCAGCTGATTTTCGGAGG - Intergenic
1151119918 17:71781467-71781489 CGCGCCCGGCTAATTTTTTTTGG - Intergenic
1151230433 17:72681097-72681119 CATGCCCAGGTAATTTTTTTGGG + Intronic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1151308305 17:73278124-73278146 CACGCCCAGCTAATTTTAAGCGG + Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1151731091 17:75911673-75911695 CACGCTCAGCTATTTTTTTGTGG + Intronic
1151735314 17:75936333-75936355 CAGGCCCAGCTAATTTTGGGGGG - Intronic
1152085970 17:78218757-78218779 CACGCCTGGCTAATTTTTTTTGG + Intronic
1152125974 17:78447093-78447115 CTCACCTAGCTATTTTTTTGTGG + Intronic
1152156967 17:78640767-78640789 CATGCCAAGCTAATTTTTTTTGG - Intergenic
1152607881 17:81302199-81302221 CACACCCGGCTAATTTTGTGGGG + Intergenic
1152764853 17:82130793-82130815 CACGCCCAGCTCCTTTTTTTTGG + Intronic
1153367478 18:4273597-4273619 AATGCCTGGCTAATTTTTTGTGG + Intronic
1153517403 18:5916948-5916970 CACGCCCAGCTATTTCTTTTTGG - Intergenic
1153638739 18:7136559-7136581 CACGCCCGGTTAATTTTTTTTGG + Intergenic
1153671838 18:7419180-7419202 CATGCCCAGCTAATTTCTTTTGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154118538 18:11633069-11633091 CAGGCCCAACTAATCTTTTTTGG + Intergenic
1154230096 18:12548767-12548789 CAGGCCTGGCTAATTTTTTTTGG + Intronic
1154345676 18:13541917-13541939 CACACCCCACTAATTTTTTTGGG - Intronic
1154974883 18:21447851-21447873 CATTCCCAGCAAGTTTTTTGAGG + Intronic
1155142357 18:23054755-23054777 CACGCCCAGCTAATTTTTATGGG + Intergenic
1155313521 18:24547999-24548021 CTCACCCAGCTAATATTTGGAGG + Intergenic
1155352483 18:24920070-24920092 CACACCCAGCTAATTTTGTGGGG - Intergenic
1155421483 18:25661305-25661327 CGCGCCAGGCTAACTTTTTGTGG - Intergenic
1155482835 18:26308095-26308117 CATGCCCAACTAATTTTGGGGGG - Intronic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1155647413 18:28095651-28095673 CATGCACAGCTAATTTTTAGTGG - Intronic
1156243352 18:35274170-35274192 CATGCCCAGCTAATTTTTGGGGG + Intronic
1156727456 18:40146798-40146820 CATGCCTGGCTAATTTTTTTAGG + Intergenic
1157931856 18:51832302-51832324 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1158032904 18:52988793-52988815 CACACACATGTAATTTTTTGTGG + Intronic
1158525830 18:58212633-58212655 CATGCCTAGCCAATTTTTTGTGG + Intronic
1158579425 18:58668756-58668778 CACGCCTGGCTAATTTTTTTTGG + Intergenic
1158690334 18:59654633-59654655 CATGCCCGGCTAATTTTGTTTGG - Intronic
1158696927 18:59711775-59711797 CACACCTGGCTAATTTTTTTTGG - Intergenic
1158800941 18:60908016-60908038 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159191028 18:65042894-65042916 CACGTCCAGCTAATTTTTTGGGG + Intergenic
1159347425 18:67225249-67225271 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1160204201 18:76820311-76820333 TATGCCTAGCTAATTTTTTGTGG - Intronic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1160536131 18:79593938-79593960 CACATCTGGCTAATTTTTTGGGG - Intergenic
1160882732 19:1329196-1329218 CATGCCCAGCTAATTTTTCTAGG - Intergenic
1160973022 19:1778253-1778275 CATGCCCATTTAATTTTTTAAGG + Exonic
1161032246 19:2062962-2062984 GACACCCAGCTAATTTGTTTTGG + Intergenic
1161272308 19:3396797-3396819 CACACCCAGCTAATTTTTGTAGG - Intronic
1161392266 19:4027714-4027736 CACGCCTGGGTAATTTTTTGTGG + Intronic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161529370 19:4778064-4778086 CACGCCTGGCTAATTTTTTGGGG + Intergenic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1161758682 19:6154239-6154261 TACGCCTGGCTAATTTTTTGGGG - Intronic
1161862672 19:6809936-6809958 CAAGACAAGCTAATTGTTTGAGG + Intronic
1161932138 19:7348034-7348056 CACGCCTGGCTATTTTTTTTTGG - Intergenic
1161968531 19:7562213-7562235 CACACCCAGCTAAATTTTGTGGG + Intergenic
1161976379 19:7610159-7610181 AACACCAGGCTAATTTTTTGTGG - Intronic
1162266352 19:9578235-9578257 CATGTCTGGCTAATTTTTTGAGG - Intronic
1162291962 19:9786650-9786672 CACAGCAGGCTAATTTTTTGTGG + Intronic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162468177 19:10855489-10855511 CACACCTGGCTAATTATTTGTGG + Intronic
1162515943 19:11147723-11147745 CACACCCGGCTAATTTTTACAGG + Intronic
1162648480 19:12067041-12067063 CACACCCAGCTAATTTTTTATGG - Intronic
1162653226 19:12107618-12107640 CATGCCCAGCTAATTTTTGTGGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1162839908 19:13348849-13348871 CACACCCAGCTAATTTTGGGGGG - Intronic
1163112802 19:15171504-15171526 CACACCTGGCTAATTTTTGGGGG + Intronic
1163573285 19:18096069-18096091 CATGCCTGGCTAATTTTTTTGGG - Intronic
1163680630 19:18680080-18680102 CATGCCTGGCTAATGTTTTGTGG - Intergenic
1163933710 19:20422998-20423020 CACACCCGGCTAATTTTGTGTGG - Intergenic
1164101367 19:22057371-22057393 AAGGCCCAGCTAATTCTTTCTGG + Intronic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1164309666 19:24034646-24034668 GACGCCCAGCTAATTTTTGCGGG + Intronic
1165129999 19:33625927-33625949 CATGCCCAGCCAACTTTCTGAGG - Intronic
1165165741 19:33854252-33854274 CATGCCCGGCTAATTTTTCATGG - Intergenic
1165430962 19:35772460-35772482 CAGGCCCAGCTAATTTTTAGTGG - Intergenic
1165491114 19:36123415-36123437 CACCCCCGGCTAAAGTTTTGTGG + Intronic
1165539434 19:36479787-36479809 CAAGTCCAGCTAAATGTTTGGGG + Intronic
1165812787 19:38622060-38622082 CATGCCCAGCTAATTTTACTTGG + Intronic
1165822946 19:38688412-38688434 CATGTCCAGCTAATTTTTGTGGG - Intronic
1166111657 19:40626694-40626716 CACCCCCATCTAATTTCTTCAGG + Intronic
1166358983 19:42244223-42244245 CACGCCCAGCTAATTTGGTTTGG + Intronic
1166385875 19:42380574-42380596 CAGGCCCGGCTATTTTTTTTTGG + Intergenic
1166577193 19:43853316-43853338 CACGCCTGGCTAATGTTTTTGGG - Intergenic
1166977820 19:46615030-46615052 CACACCTGGCTAATTTTTTTTGG - Intergenic
1167062843 19:47161160-47161182 CATGCTCTGCTAATTTTTTCGGG + Intronic
1167082894 19:47289435-47289457 CGTGCCCGGCTAATGTTTTGTGG + Intergenic
1167369969 19:49074716-49074738 CACACGCGGCTAATTGTTTGTGG + Intergenic
1167434206 19:49469729-49469751 CATGCCCAGCTAATTGTTGGGGG + Intronic
1167750571 19:51377185-51377207 CACTCCCAGCTAATTTTTTGGGG - Intergenic
1167892090 19:52548577-52548599 CACACCCGGGTAATTTTTGGTGG + Intronic
1167915529 19:52736899-52736921 CACGCCTGGCTAATTTTTTTGGG + Intergenic
1167947428 19:52999984-53000006 CACATCCAGCTAATTTTTAGTGG - Intergenic
1167951378 19:53030452-53030474 CACGCCCAGCTAACTTTTGTGGG - Intergenic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168223049 19:54974954-54974976 CAGGCCCGGCTAATTTTTTGTGG + Intronic
1168260796 19:55193272-55193294 CATGCCCAGCTATTTTGTTGGGG - Intronic
1168419859 19:56194443-56194465 CACGCCCGGCTAATTTTTATAGG + Intronic
1168428162 19:56256347-56256369 CACACCCGGCTAATCTTTTGTGG + Intronic
1168432483 19:56292417-56292439 CACACCTAGCTAATTATTTTTGG + Intronic
1168624067 19:57902815-57902837 CATGCCCGGCTAATTTTTTGTGG + Intronic
925246913 2:2391773-2391795 TATGCCCAGCTATTTGTTTGTGG - Intergenic
925426153 2:3750414-3750436 CACGCCAAGAAAATTTTTAGAGG - Intronic
925536769 2:4926541-4926563 CATGCCCGGCTAATGTTTTTTGG + Intergenic
925868664 2:8250782-8250804 CACCACCAGATAATTTTTTTAGG - Intergenic
926032976 2:9608781-9608803 CACGCCTGGCTAATTTTTGTAGG - Intronic
926180252 2:10636449-10636471 CACACCCAGCTAATTTTGTTTGG - Intronic
926725521 2:15994495-15994517 CAAGCCCGGCTAATTTTGTGGGG + Intergenic
927034177 2:19155801-19155823 CAGGCCCAGCTAATTTTTCTAGG - Intergenic
927541396 2:23914683-23914705 CTCGCCCGGCTAATTTTTTTTGG - Intronic
927724197 2:25408380-25408402 CACACCCAACTAATTTTTGTTGG - Intronic
927733959 2:25501534-25501556 CATGCCCAGCTAATTTTTGTTGG + Intronic
927941828 2:27108937-27108959 CATGCCCAGCTTTTTTTTTTTGG + Intronic
928019432 2:27690641-27690663 AATGCCCAGCTAATTTTTGTGGG + Intronic
928508875 2:31983102-31983124 CACACCCAGCTAATTTTTGTGGG - Intronic
928966749 2:36983569-36983591 CACACCCAGCTAATATTTTTGGG - Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
929126692 2:38529143-38529165 CACACCCAGCAAATTTTTTTTGG + Intergenic
929475680 2:42245249-42245271 CATGCCTGGCTAATTTTTTGTGG + Intronic
929512074 2:42572420-42572442 CATGCCCGGCTATTTTTTTTTGG - Intronic
930119185 2:47746126-47746148 CACACCTGGCTAATTTTTAGTGG - Intronic
930168818 2:48230675-48230697 AATGCCCAGATAATTTTTTAGGG - Intergenic
931270006 2:60693275-60693297 CACGCCCGGCTAATTTTTTTTGG - Intergenic
931329665 2:61267597-61267619 TACACCCAGCTAATTTTTTGTGG + Intronic
931381241 2:61755475-61755497 CACGCCGGGCTAATTTTTGTGGG + Intergenic
931670685 2:64644231-64644253 CATGCCCAGCTAATTTTACCAGG - Intronic
931672889 2:64664823-64664845 CATGCCCAGCTAATTTTTATGGG + Intronic
931766590 2:65462241-65462263 CATGCCCAGCTAGGTTTTTTTGG - Intergenic
932072892 2:68638361-68638383 TATGCCCAGCTAAGTTTTTCAGG - Intergenic
932686082 2:73871389-73871411 CACGCCTGGCTAATTTTTTTTGG - Intronic
933119936 2:78523835-78523857 CATGCCAAGCTAATTTTTTTGGG - Intergenic
933169994 2:79114527-79114549 CATGCCCAGCTAATTTTTGACGG + Intergenic
933712831 2:85340181-85340203 CATGCCCAGCTAATTTTTCTGGG + Intergenic
933720809 2:85396340-85396362 CACACTCAGCTAATTTTGGGGGG + Intronic
933845300 2:86321451-86321473 CACCCCCAGCTTAGTTTATGAGG + Intronic
934866065 2:97812845-97812867 CATGCCCAGCTAATTTTGGGGGG - Intronic
935029527 2:99308866-99308888 CACGCCTGGCTAATTTTTAGTGG + Intronic
935033576 2:99345784-99345806 CACACTCAGCTATTTTTTTTAGG - Intronic
935159195 2:100514589-100514611 CATGCCTAGCTAATTTTTTGGGG + Intergenic
935632839 2:105226074-105226096 CACACCCAGCTAATTTTTGTGGG - Intergenic
935833371 2:107023615-107023637 TACGTCCTGCTAATTTTTTTTGG + Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
935969436 2:108516099-108516121 CACGCCCGTCTAATTTTTTTGGG + Intergenic
936843233 2:116799594-116799616 CAGGTTCAGCTAATTTTTTGTGG + Intergenic
937108012 2:119337209-119337231 CATGCCCAGCTAGTTTTTTGGGG + Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937650355 2:124312519-124312541 CACACCCAACTAATTTTTGTGGG + Intronic
937950121 2:127378949-127378971 CACGTCTGGCTAATTTTGTGGGG + Intronic
937972630 2:127562451-127562473 CACGCCCAGCTAATTTTTGTGGG + Intronic
938043830 2:128098591-128098613 CACACTCAGCTATTTTTTTCTGG - Intronic
938272289 2:129983720-129983742 CACGCCCAGCTAATTTTTGTAGG - Intergenic
938821023 2:134960324-134960346 CATGCCCGGCTAATTTTGGGGGG + Intergenic
938838812 2:135137980-135138002 CATGCCTGGCTAATTTTTCGTGG + Intronic
938909255 2:135870902-135870924 CATGCCCAGCTAATTTTTGTGGG + Intronic
939528113 2:143321843-143321865 CACACCCTGCTACATTTTTGTGG + Intronic
939924712 2:148158874-148158896 CATGCCTGGCTAATTTTTTTTGG + Intronic
940415068 2:153410239-153410261 CACACTCAGCTATTTTTTTAGGG + Intergenic
940648633 2:156418235-156418257 CACGTCCGGCTAATTTTTGTGGG - Intergenic
940769454 2:157824908-157824930 CACGCCTGGCTAATTTTTGGTGG + Intronic
940882728 2:158962638-158962660 CACGCCCAGCTAATTTTTATTGG - Intergenic
941995455 2:171597546-171597568 CAAGGCCAGATAATTTTTTTAGG + Intergenic
942135527 2:172921251-172921273 CATGCCCAGCTAGTTTTTTGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
942345438 2:174997841-174997863 CACACCCAGCTAATTTTTGTTGG - Intronic
942647410 2:178128160-178128182 CATGCCCAGGTAATTTTTTTTGG + Intronic
942977648 2:182038192-182038214 CATGACCAGCTAATGTTTTGTGG + Intronic
943560048 2:189450485-189450507 CACGCCTGGCTAATTTTTGTAGG + Intronic
943673896 2:190697649-190697671 CATGCTCAGCTAATATTTTAAGG + Intergenic
944544953 2:200790071-200790093 CATGCCTGGCTAATTTTTTTGGG - Intergenic
944626858 2:201579395-201579417 CATGCCTGGCTAATTTTTTGTGG + Intronic
944742237 2:202623843-202623865 CATGCCCGGCTAATTTTTAGTGG - Intergenic
944767520 2:202879575-202879597 CACACCCGGCTAATTTGTTTTGG + Exonic
944831763 2:203540135-203540157 CACGCCTGGCTAATTTTTTGTGG + Intergenic
945266782 2:207898599-207898621 CATGCCCAGCTAATTTTTGTGGG - Intronic
945285848 2:208080637-208080659 CACACCTGGCTAATTTTTTGTGG - Intergenic
945351237 2:208783335-208783357 CAACCCCAGCTAATGTGTTGTGG - Intronic
945777978 2:214131210-214131232 TATGCCCAGCTACTTTTTTTTGG - Intronic
945890813 2:215428856-215428878 CACAGCCGGCTAATTTTTTTTGG - Intronic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
945958408 2:216107470-216107492 CAAGCCCAGCTAATTTTTGTGGG - Exonic
946288575 2:218725374-218725396 CATGCCTAGCTAATTTTTTATGG + Intronic
946288706 2:218726620-218726642 CACATCCAGCTAATTTTTTCTGG + Intronic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
946854637 2:223940797-223940819 CATGCCCAGCTAATTTTTGTGGG + Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
947881342 2:233516529-233516551 CAGGCCCGGCTAATTTTTAGTGG - Intronic
948013896 2:234672241-234672263 CGCACCCAGCTGATTTTTTTAGG + Intergenic
948436865 2:237959728-237959750 TGCGCCCAGCTAATTTTTTGTGG - Intergenic
948438631 2:237970863-237970885 CATGCCGAGCTAATTTTTTTTGG + Intronic
948900109 2:240952188-240952210 CATGCCCGGCTAATTTTTTGTGG - Intronic
1168791829 20:582817-582839 CACACCCGGTTAATTTTTTTTGG - Intergenic
1168862247 20:1053952-1053974 CACGCCCAGCTAATTTTGTATGG - Intergenic
1169043176 20:2512941-2512963 CACACCCAGCTATTTTTGAGGGG - Intronic
1169067504 20:2702269-2702291 CATGCCCAGCTAATTAATTTTGG - Intronic
1169071400 20:2734250-2734272 CATGCCCAGCTAATTTTTGTAGG - Intronic
1169076705 20:2764443-2764465 CACACCCAGCTAATTTTTTAGGG + Intergenic
1169107068 20:3005391-3005413 CATGCCTGGCTAATTTTTTAAGG - Intronic
1169126759 20:3133907-3133929 CACATCCGGCTAATTTTTGGGGG + Intronic
1169181753 20:3575118-3575140 TATGCCCAGCTAATTTTTCTAGG + Intronic
1169223582 20:3841726-3841748 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1169338528 20:4777222-4777244 CATGCCCAGCTAATTTTGGGGGG + Intergenic
1169396301 20:5233030-5233052 CACACCCAGCTTATTTTTTTTGG - Intergenic
1169489196 20:6056887-6056909 CACGCCTGGCTAATTTTTAGGGG + Intergenic
1169890872 20:10450906-10450928 TACGCCCGGGTAATTTTTTTGGG + Intronic
1170525615 20:17233387-17233409 AACCCACAGCTACTTTTTTGAGG - Intronic
1170983575 20:21237984-21238006 CATGCCTGGCTAATTTTTTGTGG + Intronic
1172043603 20:32063407-32063429 CATGCCTGGCTAATTTTTTTGGG + Intronic
1172147971 20:32770443-32770465 CACCACCAGCTAATTTTTGTTGG + Intronic
1172180711 20:33001823-33001845 CACGCCCGGCTAATTTTTGTGGG + Intronic
1172248147 20:33460227-33460249 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1172311962 20:33925435-33925457 CAAGCCTGGCTAATTTTTTAAGG - Intergenic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1172406791 20:34695759-34695781 CACGACCTGCTAATTTTTTTTGG - Intergenic
1172609946 20:36243012-36243034 CACGCCCAGCTAATTATTTTTGG + Intronic
1172697092 20:36830409-36830431 CATGCCAAGCTAACTTTTTTGGG - Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1172912423 20:38419891-38419913 CGTGCCTGGCTAATTTTTTGTGG + Intergenic
1173203557 20:40972417-40972439 CATGCCCAGCTTATTTTTTAAGG + Intergenic
1173380394 20:42534477-42534499 CATGCCCGGCTAAATTTTTTTGG - Intronic
1173482983 20:43417502-43417524 CATGCCCAGCTAATTTTTGCTGG + Intergenic
1173516925 20:43671123-43671145 CATGCCCAGCTAATTTTTGTGGG + Intronic
1173614647 20:44394825-44394847 CATGCCCAGTTAATTTTTTAAGG + Intronic
1173679778 20:44869861-44869883 AAGGCCCAGCTAATTTTTTGTGG - Intergenic
1173781183 20:45758733-45758755 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1174009753 20:47440012-47440034 CACGCCCAGTTAATTTTGTATGG - Intergenic
1174009987 20:47442003-47442025 CATGCCCAGCTAACTTTTTTAGG + Intergenic
1174016333 20:47491334-47491356 CATGCCCGGCTAATTTTTGTAGG + Intergenic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174313776 20:49681057-49681079 CACGCCTGGCTAATTGTTTTTGG - Intronic
1174316728 20:49708773-49708795 CACACCCGGCTAATTTTTGATGG - Intronic
1174470906 20:50759871-50759893 CACACTCAGCTAATATTTTTCGG + Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174596162 20:51685403-51685425 CACGCCCAGCTAACTTTTTTTGG - Intronic
1174641365 20:52047282-52047304 CATGCCCAGCTAATTTTTGGTGG + Intergenic
1174841895 20:53908914-53908936 CATGCCCAGCATATTTTTTGTGG - Intergenic
1175058099 20:56216509-56216531 CATGCCCAGCTAATTGTTTGGGG - Intergenic
1176068117 20:63210629-63210651 CACGCCTGGCTAATTTTTTTTGG - Intronic
1176202720 20:63869969-63869991 CACACCTGGCTAATTTTTGGGGG - Intronic
1176519560 21:7814363-7814385 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1176921499 21:14692965-14692987 CACGTCTGGCTAATTTTTTGTGG + Intergenic
1177965105 21:27718006-27718028 CACGCCCGACTAATTTTTTTTGG + Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1178418150 21:32420540-32420562 CAGGCCTAGCTAATTTTTTTTGG + Intronic
1178568637 21:33713394-33713416 CACGCCTGGCTAATTTTTTTTGG + Intronic
1178653588 21:34444376-34444398 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1179768930 21:43598359-43598381 CACACCCGGCTAATTTTTGTGGG + Intronic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1180462801 22:15582414-15582436 CACGCCCCACTAATTTTTGTAGG + Intergenic
1180581384 22:16842096-16842118 CAGGCTCGGCTAATTTTTTTTGG + Intergenic
1180687116 22:17677887-17677909 CATGCCCAGCTAATTTTTGTGGG - Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181309369 22:21936014-21936036 CACACACAGCTAATTTTTTTTGG - Intronic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1181536082 22:23546159-23546181 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1181806428 22:25377214-25377236 TATGCCCAGCTAATTTTTGGTGG + Intronic
1182386974 22:29952043-29952065 CACGCCCAGCTAATTTTTGTGGG + Intronic
1182427355 22:30281743-30281765 CATGCCCAGCTAATTATTTTTGG + Intergenic
1182634891 22:31718226-31718248 CCCGCCCAGCTAATTTTTTGGGG + Intronic
1182760221 22:32716685-32716707 CATACCCGGCTAATTTTTTGTGG + Intronic
1183042745 22:35194602-35194624 CACGCCCGGCTAATTCTTAATGG + Intergenic
1183132681 22:35854428-35854450 CATACCCAGCTAATTTTTTTGGG - Intronic
1183214209 22:36468568-36468590 CATGCCTGGCTAATATTTTGGGG - Intronic
1183487286 22:38095654-38095676 CGCGCCCAGCCTAATTTTTGTGG + Intronic
1183813218 22:40275800-40275822 CACACCCAGCTAATTTTTGTAGG - Intronic
1183851491 22:40592643-40592665 CATGCCTGGCTAATTTTTTTTGG + Intronic
1183861236 22:40671779-40671801 CACGCCTGGCAAATTTTTTGTGG + Intergenic
1184084903 22:42255330-42255352 CAAGCCCGGCTACTTTTTTTTGG - Intronic
1184706264 22:46215583-46215605 CACGCCTGGCTAATTTTTTTTGG - Intronic
1184721272 22:46315043-46315065 CACACCCGGCTAATTTTTGTGGG + Intronic
1185287217 22:50007525-50007547 CACACTCAGTTAATTTTTTTGGG + Intronic
949238133 3:1836118-1836140 CATGCTCAGCTAACTTTTTTTGG + Intergenic
949496234 3:4634893-4634915 CACACCTGGCTAATTTTTGGGGG + Intronic
949695649 3:6691981-6692003 CACGCTCAGCTTATTTTATGAGG + Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
951333618 3:21394804-21394826 CACACCGAGCTAATTTTTTGTGG + Intergenic
951351119 3:21608164-21608186 CACACTTGGCTAATTTTTTGTGG + Intronic
951539686 3:23770556-23770578 CACGATCGGCTAATTTTTTTTGG - Intergenic
951667822 3:25146659-25146681 CGCGCCCGGCTAATTTTTTGTGG + Intergenic
952315717 3:32230550-32230572 CATGTCCGGCTAATTTTTTGGGG + Intergenic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
952654229 3:35764693-35764715 CAAGCCTAGATAATGTTTTGTGG + Intronic
953163332 3:40442454-40442476 CATGCCTGGCTAATTTTTTTGGG - Intergenic
953775241 3:45811061-45811083 CATGCCCAGCTAATTTTTACAGG - Intergenic
953801457 3:46027035-46027057 CACACCTAGCTAATTTTTTGGGG + Intronic
953865981 3:46583904-46583926 CATGCCCGGCTAACTTTTTGGGG + Intronic
953887909 3:46728196-46728218 CACGCCCGGTTAATTTTTTTGGG + Intronic
953973373 3:47364309-47364331 CAAGCCTGACTAATTTTTTGAGG + Intergenic
954065627 3:48103735-48103757 CGCGCCTGGCTAATTTTTTGTGG + Intergenic
954241997 3:49301094-49301116 CATGCCTGGCTAATTTTTTTAGG + Intronic
954261163 3:49439911-49439933 CACGGCCAGCTAATTTTTGACGG + Intergenic
954669843 3:52284328-52284350 CATGCCTGGCTAATTTTTTGTGG - Intronic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
954820050 3:53318146-53318168 CACTATCAGCTAATTTTTTGGGG - Intronic
954835842 3:53467224-53467246 CAGCCCCAGCTAATTTTTTATGG - Intergenic
954883846 3:53854958-53854980 CACGCCCGGCTAATTTTTTGTGG - Intronic
955244942 3:57216453-57216475 CAGGCCTGGCTAATTTTTTGTGG - Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956462847 3:69488734-69488756 CATGCCCAGCTAATTTTTAGTGG - Intronic
956994322 3:74806573-74806595 AGGGCCCAGCTAATTTTCTGGGG - Intergenic
957131528 3:76228853-76228875 CATGCCCCACTAATTTTTTAAGG - Intronic
957269500 3:78011234-78011256 TGCGCCCAGCTAATTTTTTTTGG + Intergenic
957546903 3:81650819-81650841 CATGCTCAGCTAATTTTGGGGGG + Intronic
957798587 3:85044492-85044514 CAACCCCAGCTAATTTCTTCTGG - Intronic
959538382 3:107512705-107512727 CACGCCCAGCCAATTTTTTTTGG - Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
960034550 3:113089163-113089185 CGCGCCTGGCTAATTTTTTTTGG + Intergenic
960163185 3:114372686-114372708 CACAGCCAGCTAGTTTTTTGGGG - Intronic
960635181 3:119777900-119777922 CATGCCCAGCTATTTTTTTCTGG - Intergenic
960809598 3:121615046-121615068 CACACCCAGCAAACTTTTTGTGG - Intronic
960823217 3:121756495-121756517 CATGCCCAGCTAATTTTTGTGGG + Intergenic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961139011 3:124539902-124539924 CACACCAAGCTAATTTTTTTTGG + Intronic
961837752 3:129678082-129678104 CACACCTGGCTAATTTTTAGTGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962448173 3:135487356-135487378 TGAGCCCAGCTAATTTCTTGAGG - Intergenic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962607704 3:137046063-137046085 CATGCCCAGCTAATTTTTGCAGG - Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963129705 3:141846991-141847013 CATGCCCGGCTAATTTTTGTGGG + Intergenic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963716097 3:148805538-148805560 CACGCCCGGCTAATTTTTTGTGG - Intronic
963894787 3:150673743-150673765 CACGCCCAGCTAACACTTTGTGG + Intronic
964038127 3:152223423-152223445 CACGCCTGGCTAATTTTTTTTGG + Intergenic
964148204 3:153491974-153491996 CACGCCCAGCCTAGTTTTTGAGG - Intronic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
964721575 3:159772308-159772330 CATGCCCAACTAACTTTTTAGGG + Intronic
965819870 3:172674285-172674307 CACACCCGGCTAATTTTCTTTGG - Intronic
966178484 3:177165931-177165953 CATGTCCAGCTAATTTTTTGTGG - Intronic
966321278 3:178703514-178703536 CACGAACAGCTACTTTTTTTGGG - Intronic
966408301 3:179622122-179622144 CATGCCCAACTAATTGTTTAGGG + Intronic
966547223 3:181163320-181163342 TACGCCCAGCTAATTTTTGGTGG - Intergenic
966716143 3:183014868-183014890 TACACCCAGCTTATTTTTTGTGG + Intergenic
967032885 3:185624709-185624731 CAGACCCAGTTAATTTTTAGTGG - Intronic
967082978 3:186067453-186067475 CACGCCTGGCTAATTTTTTTAGG - Intronic
967148893 3:186630202-186630224 CACACCCAGCTAATTTTTGTGGG + Intergenic
967200893 3:187071602-187071624 CACGCCCGGCTAATTTTTTGGGG - Intronic
967215706 3:187208401-187208423 CACGCCCAGCTAATTAGTGAAGG - Intergenic
967960934 3:194923435-194923457 CATGACCAGCTAATTTTTTGTGG + Intergenic
967980786 3:195063989-195064011 CACGCCCAGCAAGTTATCTGTGG + Intergenic
968053146 3:195670008-195670030 CATGCCCAGCTAATTTTTGAGGG + Intergenic
968102667 3:195978353-195978375 CATGCCCAGCTAATTTTTGAGGG - Intergenic
968168302 3:196486902-196486924 CATGCCTGGCTACTTTTTTGTGG - Intronic
968277230 3:197449634-197449656 CACGACCAGCTAATTTTTTATGG - Intergenic
968320934 3:197767619-197767641 TATGCCCAACTAATTTTTAGAGG + Intronic
968429409 4:546854-546876 CACACCCAGCTAAATATTTAGGG + Intergenic
968775996 4:2540488-2540510 CACGCCTGGCTAATTTTTTGGGG - Intronic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969365503 4:6691853-6691875 CACACCAGGCTAATTTTTTGGGG - Intergenic
969953932 4:10868592-10868614 CACACCCTGCTAATTTTTCTTGG + Intergenic
970339212 4:15086600-15086622 CACCCCCTGCTTTTTTTTTGAGG - Intergenic
970501857 4:16685893-16685915 CATGCCCAACTACTTTTTTTTGG - Intronic
970528144 4:16953811-16953833 CAAACCCAGCTCCTTTTTTGTGG + Intergenic
970618483 4:17791585-17791607 CACACCCAGCTAATTTTTGTAGG - Intergenic
970774502 4:19656718-19656740 CATGCCCGGCTAATTTTTTTTGG - Intergenic
970885976 4:20987842-20987864 CACGCCCGGCTAATTTTTTTTGG - Intronic
971360746 4:25936349-25936371 CATGCCCAGCTAACTTTTTTTGG - Intergenic
971648379 4:29238133-29238155 CACGCCCAGCTAAGTTTTGTGGG - Intergenic
971792698 4:31188972-31188994 CTCGCCCAGCTATTTTATTTTGG + Intergenic
971908420 4:32760291-32760313 CACACTCAGCTAATTTTTGCGGG - Intergenic
972334695 4:38097317-38097339 CATGCCTGGCTAATTTTTTGTGG + Intronic
972392007 4:38622648-38622670 CACACCTGGCTAATTTTTTGTGG + Intergenic
972441622 4:39099129-39099151 CATGCCTGGCTAATTTTTTTTGG - Intronic
972463499 4:39329337-39329359 CCTCCCCAGCTAATTTTTTTTGG - Intronic
972626419 4:40803903-40803925 CACACCTGGCTGATTTTTTGTGG - Intronic
972657115 4:41074982-41075004 CGTGGCCAGATAATTTTTTGTGG - Intronic
973125616 4:46580517-46580539 CACGCCTGGATAATTTTTTTAGG + Intergenic
973991442 4:56412464-56412486 CATGCCTGGCTAATTTTTTGTGG + Intronic
974053312 4:56961359-56961381 CACACCTGGCTAATTTTTTTGGG + Intergenic
974246455 4:59325861-59325883 CACGCCCGGCTAAGTTTTTCGGG + Intergenic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
975701125 4:77067645-77067667 CAAGCCCAGGTAATTTTGTGGGG + Intronic
976626233 4:87186193-87186215 CACGCCTGGCTAATTTTTGTGGG + Intronic
976630736 4:87233415-87233437 AACGCCCAGCTAATTTTTGTTGG - Intronic
976775536 4:88701957-88701979 CAGGCCTGGCTAATTTTTTGTGG + Intronic
976779973 4:88748044-88748066 CACGCCCGGCTAATTTTTTTTGG + Intronic
977196447 4:94067065-94067087 CATGCCCAGCTAATTTTTGTGGG + Intergenic
977639471 4:99340255-99340277 TGTGCCCAGCTAATTTTTTTGGG - Intronic
977833188 4:101617502-101617524 CACGCCAGGCTAATTTTTTTGGG + Intronic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
978595020 4:110368071-110368093 CACGCCCGGCTAATTCTTTTTGG + Intronic
980102684 4:128557411-128557433 CACACTCAGCTAATTTTTTCTGG + Intergenic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
980690388 4:136289426-136289448 CAAGCCCGGCTTATTTTTTTTGG - Intergenic
980818151 4:137975876-137975898 CACGCCTGGCTAATTTTTGTGGG + Intergenic
981294883 4:143120351-143120373 CATGCCTGGCTAATTTTTAGTGG - Intergenic
981427137 4:144616543-144616565 CCTGCCCAGCTACTTTGTTGTGG - Intergenic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981998756 4:151002855-151002877 TACACCCAGCTAATTTTTTGGGG - Intronic
982716619 4:158815537-158815559 CACGCCCAGCTAATTTGACGGGG + Intronic
982922609 4:161294246-161294268 CACGTCCAGGTAATTTCTTTTGG - Intergenic
983167473 4:164495950-164495972 CACTCCCGGCTAATTTTTTTTGG - Intergenic
983304151 4:165964778-165964800 CATGCCCAGCTAATTGTTGTTGG - Intronic
983328073 4:166285888-166285910 CACCCGCAGCTAATTTTTTTGGG + Intergenic
983467668 4:168115041-168115063 CATGCCCAGCTAATTTTGTATGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984083932 4:175284905-175284927 TATGCCCAGCTAATTTTTGATGG + Intergenic
984304691 4:177973462-177973484 CACGCCCGGTTAATTTTTTTTGG + Intronic
984329734 4:178299020-178299042 CATGCCCAGCTAATTTTTGTGGG - Intergenic
984769926 4:183428441-183428463 CATGCCCAGCTAATTTTTCTGGG - Intergenic
985300388 4:188482257-188482279 CACACCTGGCTAATTTTTTTTGG + Intergenic
985499399 5:232365-232387 CATGCCCAGCTAATTTTCGAGGG + Intronic
987592734 5:19952204-19952226 CACACCTGGCTAATTTTTTGTGG + Intronic
987649239 5:20719259-20719281 TATGCTCAGCTAATTTTTTGTGG + Intergenic
987939989 5:24521448-24521470 CATGCCCACCTAATTTTGTAAGG - Intronic
987985667 5:25142285-25142307 CACGCCCAGCTAATTTTTAGTGG + Intergenic
988046814 5:25967005-25967027 CTCGCCCAGCTCATTTTTGAGGG - Intergenic
988512487 5:31877370-31877392 CACGCTGAGCTAATATTTTTTGG + Intronic
988654781 5:33197884-33197906 CATGCCCAGCTGATTTTGTGAGG - Intergenic
988746321 5:34142273-34142295 TATGCTCAGCTAATTTTTTGTGG - Intergenic
988921827 5:35949359-35949381 CACGCCTGGTTAATTTTTTGTGG + Intergenic
989018308 5:36967938-36967960 CTTGCCTGGCTAATTTTTTGTGG - Intronic
990169586 5:53033110-53033132 CACGCCCTGCTAATTTTTTATGG - Intronic
990467770 5:56086167-56086189 CACGCCTGGCTAATTTTGGGGGG - Intergenic
991457480 5:66819928-66819950 CATACCCAGCTAATTTTTGTGGG + Intronic
991481221 5:67082303-67082325 CACGCCCAGCTAATTTTTGTTGG + Intronic
992012687 5:72544971-72544993 CACGCCTGGCTAATATTTTTGGG + Intergenic
992081418 5:73236872-73236894 CATGCCCGGCTAATTTTTGTGGG - Intergenic
992113127 5:73514789-73514811 CACACCCAGCTAATTTATTTTGG - Intergenic
992666786 5:79018202-79018224 CATGCCCGGCTAATTTTTTGTGG + Intronic
992740221 5:79766253-79766275 CAAGCCCCGCTAATTTTTTTGGG + Intronic
993173498 5:84451981-84452003 CATGCCCGGCTAATTTCTTTTGG - Intergenic
993273773 5:85830235-85830257 CACACCCAGTTAATTTTTGTGGG + Intergenic
993611263 5:90057457-90057479 CATTCCTAGCTAATTTTTTCTGG - Intergenic
993809920 5:92463537-92463559 CACACCCAGCTAAATGTTTCTGG - Intergenic
994089030 5:95792228-95792250 CACGCCCGGATAAGTTTTTTTGG - Intronic
994433761 5:99702227-99702249 CATGCCCAGATAATTTTTTTTGG + Intergenic
994697615 5:103092171-103092193 CATGCCCGGCTAATTTTTGTAGG + Intronic
995442568 5:112208087-112208109 CACTCCCAGCTAATTTTTGTAGG - Intronic
995517180 5:112965905-112965927 CATGCCTAGCTAATCTTTTTGGG + Intergenic
995680841 5:114717792-114717814 CAGGCCCAGCTACTTTTTTTTGG - Intergenic
996071919 5:119140738-119140760 CCTCCCCAACTAATTTTTTGAGG + Intronic
996638697 5:125727742-125727764 CATGCCCAGCAAATTTTTTGTGG + Intergenic
996739881 5:126789050-126789072 CACGACTGGCTAATTTTTTGTGG + Intronic
996847074 5:127911862-127911884 CATGCCCAGATAATTGTTTTTGG + Intergenic
996870047 5:128180259-128180281 CACGCCCAGCCCATTCTTTTGGG + Intronic
997009122 5:129856144-129856166 CACACTGGGCTAATTTTTTGTGG - Intergenic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
997411490 5:133694420-133694442 CATGCTCAGTTAATGTTTTGTGG - Intergenic
997754873 5:136386777-136386799 CACGGCGAGAAAATTTTTTGGGG + Intronic
997903750 5:137793770-137793792 CATGCCTGGCTAAGTTTTTGTGG + Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
997971020 5:138402083-138402105 CGTGCCCAGCTAATTTTTTTTGG + Intronic
997971323 5:138404879-138404901 CATGCCCTGCTAATTTTTGTGGG + Intronic
998032202 5:138880300-138880322 CATGCCTGGCTAATTTTTTGTGG + Intronic
998087174 5:139336041-139336063 CATGCCCAGCTAATTTTTGTAGG + Intergenic
998508570 5:142692178-142692200 CACACCCAGCTAATTTTTGTGGG - Intronic
998785602 5:145705345-145705367 TATGCCCAGCTAATTTTTGTGGG + Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999458468 5:151737522-151737544 CATGCCCAGCTAATTTGTCCTGG + Intergenic
999682656 5:154074564-154074586 CACACCCAGCTAATTGTGTGGGG + Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000092426 5:157941244-157941266 CACGCCCAGCTAATTTTTGTGGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1000310618 5:160040741-160040763 CACTCCCAGCTAATTTTGTTTGG + Intronic
1000311833 5:160052337-160052359 CATGCCTGACTAATTTTTTGTGG - Intronic
1000340945 5:160276939-160276961 AACACCCAGCTAATTTTTGTGGG + Intronic
1000570189 5:162902367-162902389 CCCGCCCAGTTAATTCTTTTTGG - Intergenic
1000613768 5:163405469-163405491 CATGCCCACCTAATTATTTTTGG + Intergenic
1000652410 5:163833408-163833430 CATGTCCGGCTAATTTTTTTTGG - Intergenic
1000896200 5:166858452-166858474 CAGGCCCAGCTATTTTTTTTGGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1001962621 5:175889116-175889138 CACACTCAACTAATATTTTGGGG - Intergenic
1001978201 5:176018177-176018199 CACATCCAGCTAATTTTTAGGGG + Intronic
1002005663 5:176232088-176232110 CACGCCTGGCTAATTTTTTTTGG - Intergenic
1002015531 5:176318950-176318972 TAAGCCCAGCTAATTTTTTGTGG - Intronic
1002150036 5:177221018-177221040 CACCCCCGGTTAATTTTGTGTGG + Intronic
1002162737 5:177325630-177325652 CATGCCCAGCTAGTTTTTGGCGG - Intergenic
1002220717 5:177678533-177678555 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1002239218 5:177825585-177825607 CACATCCAGCTAATTTTTAGGGG - Intergenic
1002392240 5:178924214-178924236 CATGCCCGGCTAATTTTTTGTGG - Intronic
1002511068 5:179718155-179718177 CACGCCTGGCTAATTTTTATGGG + Intronic
1002592044 5:180297283-180297305 CACACCCGGCTAATTTTTTTTGG - Intergenic
1002628516 5:180551198-180551220 GAAGCCCAGCTAATTATCTGGGG - Intronic
1002678631 5:180940934-180940956 CAAGCCCAGCTAATTTTTATGGG - Intronic
1003836588 6:10077875-10077897 CACACCTGGCTAATTTTTAGTGG - Intronic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1004447927 6:15718291-15718313 CACACCCAGCTAATTTATAAGGG - Intergenic
1004814350 6:19296479-19296501 CACATCCGGCTAATTTTTTTTGG - Intergenic
1004896243 6:20150718-20150740 TACGCCCAGCTAATTTTTTTTGG + Intronic
1005432752 6:25775590-25775612 CATGCCTGGCTAATTTTTTGTGG + Intronic
1005477553 6:26222658-26222680 CATGCCCGGCTTATTTTTTTGGG - Intergenic
1005544469 6:26850506-26850528 TACGCTCAGCTAATTTTTTGTGG - Intergenic
1005682854 6:28224349-28224371 CATGCCCAGCATTTTTTTTGGGG - Intergenic
1005731949 6:28706250-28706272 CATGCCCAGCTAATTAATTTTGG + Intergenic
1006142543 6:31938952-31938974 CACACCTGGCTAATTTTTTGTGG + Intronic
1006628754 6:35416227-35416249 GGCGCCCAGCTAGTTTTTTTTGG - Intronic
1006956052 6:37873112-37873134 CGCGCCTGGCTAATTTTTTGGGG - Intronic
1007040404 6:38716113-38716135 CACGCCCGGCTAATTTTTTTTGG + Intronic
1007153950 6:39724294-39724316 CACGCCCGGTTAATTTTTTGTGG - Intronic
1007508050 6:42352157-42352179 CATGCCTGGCTAATTTTTTATGG + Intronic
1007532252 6:42553506-42553528 CATGCTCCGCTAATTTTTTAAGG + Intergenic
1007573396 6:42909428-42909450 CGTGCCCAGCTAATTTTTTTTGG + Intergenic
1007646326 6:43384377-43384399 CATGCCTGGCTAATTTTTTTGGG + Intergenic
1007654227 6:43442571-43442593 CAAGCCCAGCTAAATTTTTTTGG - Intronic
1007760482 6:44130594-44130616 CATGCCCAGCTAAATTTTGGTGG + Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1009004452 6:57765425-57765447 CACCCCCGGCTAATTTTTTTTGG - Intergenic
1009015257 6:57892134-57892156 TACGTTCAGCTAATTTTTTGTGG - Intergenic
1009930750 6:70174401-70174423 CACGCTTGGCTAATTTTTGGTGG - Intronic
1010041474 6:71389920-71389942 CATGCCTGGCTAATTTTTTGTGG - Intergenic
1010207584 6:73336688-73336710 CACGCCCGGCTAATTTAGTCGGG - Intergenic
1010652031 6:78467123-78467145 CATGCCATTCTAATTTTTTGGGG - Intergenic
1011433756 6:87315637-87315659 TATGCCCTGCTAATTTTTTTTGG - Intronic
1011566133 6:88674381-88674403 CATGCCTGGCTAATTTTTTGTGG - Intronic
1011602703 6:89074818-89074840 CACATCCAGCTAATTTTTGTGGG + Intergenic
1011605077 6:89095367-89095389 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1012358709 6:98349414-98349436 CACACCCGTCTAATTTTTTGTGG - Intergenic
1012421409 6:99069961-99069983 TATGCTCAGCTAATTTGTTGGGG + Intergenic
1012450140 6:99346543-99346565 CACGCCAGGCTAATTTTTGTGGG + Intronic
1013090903 6:106900106-106900128 CATGCCCAGCTAATTTCTGTAGG + Intergenic
1013209044 6:107970474-107970496 TACGCCTGGCTAATTTTTTGTGG + Intergenic
1013315987 6:108943675-108943697 CAAACCCAGCTAATTTTTGTGGG - Intronic
1013530395 6:111014287-111014309 CACACCTGGCTAATTTTTTGTGG + Intronic
1014156755 6:118119658-118119680 CATGCCCAGCTAATTTCTGTAGG + Intronic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1014737075 6:125105956-125105978 CAACCCCAACTAATTTTTTTAGG + Intergenic
1015064935 6:129013278-129013300 CACGCCGGGCTAATTTTTTTTGG - Intronic
1015069360 6:129071996-129072018 CACACCCAGCTAATTTGTTTTGG - Intronic
1015123924 6:129731211-129731233 CTCTCCCTGCTAATGTTTTGAGG - Intergenic
1015446471 6:133311480-133311502 CATGCCTGGCTAATTTTTTGTGG + Intronic
1015582581 6:134741889-134741911 CACGCCTGGCTAATTTTGTTTGG - Intergenic
1015586544 6:134782433-134782455 CACACCCGGCTAATTTTTTTGGG - Intergenic
1015596008 6:134867755-134867777 CATGCCCGGCTAATTTTTGGAGG + Intergenic
1015662716 6:135593680-135593702 CACCACCAGCTATTTTTTTAAGG - Intergenic
1015801925 6:137069191-137069213 CATGCCTGGCTAATTTTTGGGGG + Intergenic
1015958446 6:138622345-138622367 CACGCCCGGCTATTTTTTTTTGG - Intronic
1016318665 6:142818510-142818532 CACGCCTGGCTAATTTTTTGTGG - Intronic
1016917027 6:149253472-149253494 CACGCCCGGCTAATTTTTGATGG - Intronic
1016946744 6:149541855-149541877 CATGCCTGGCTAATTTTTTTTGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1017421353 6:154276025-154276047 CATGGCCAGCTAAATTTTTTTGG - Intronic
1017546085 6:155451779-155451801 CACGCCCAGCTAATATTTTTTGG + Intronic
1017804897 6:157936350-157936372 TACACCCAGCTAATTTTTGGGGG - Intronic
1017883106 6:158575468-158575490 CACGCCTGGCTAATTTTTGTTGG + Intronic
1017934445 6:158992434-158992456 CATGCCCAGCTAATTTTTGTGGG + Intronic
1018014150 6:159696878-159696900 CACACCCAGCTACTGTTTTTTGG - Intronic
1018206278 6:161440105-161440127 CACGCCCGGCTAATTTTTTTTGG + Intronic
1018306780 6:162466101-162466123 CATGCCCAGCTTATTATTTCTGG + Intronic
1019423051 7:960101-960123 CATGCCCAGCTAAGTTTTGTGGG + Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019585207 7:1797788-1797810 CACGCCCGGCTAATAGCTTGTGG - Intergenic
1019668729 7:2266634-2266656 CACGCCCGGCCGGTTTTTTGGGG + Intronic
1019794794 7:3041726-3041748 CACGCCGGGCTAATTTTTTGTGG + Intronic
1019923797 7:4179509-4179531 CAAGCCCAGCGGATTTTTTCCGG + Intronic
1019986132 7:4657235-4657257 CACACCTGGCTAATTTTTTTTGG - Intergenic
1019991645 7:4695957-4695979 CACACCCAGCTAATTTTTGTGGG - Intronic
1020059602 7:5142605-5142627 ACTGCCCAGCTAATTTTTTTGGG + Intergenic
1020134644 7:5580252-5580274 CATGCCCAGCTAATATTTGTGGG - Intergenic
1021684492 7:23170055-23170077 CACGCCCGGCTAATTTTTTTTGG - Intronic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022408126 7:30111774-30111796 CACACCCAGCTAATTTTGTATGG + Intronic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1022705013 7:32793995-32794017 CATGCCTGGCTAATTTTTTGGGG + Intergenic
1022732603 7:33044183-33044205 CAAGCCCAGCTAATTTTGTATGG + Intronic
1022865214 7:34411026-34411048 CATGCCTGGCTACTTTTTTGTGG - Intergenic
1023449859 7:40272017-40272039 TTTGCCCAGCTAATTTTTTATGG + Intronic
1023500081 7:40839397-40839419 CCTGCCCAGCTAATTTTTATTGG + Intronic
1023906235 7:44523572-44523594 CATGCCCAGCTGATATTTGGTGG - Intronic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024568054 7:50699980-50700002 CACGCCCGGCTAATTTTTTTTGG - Intronic
1024606143 7:51024150-51024172 CACGCCCGGCTAATTTTTTGTGG - Intronic
1024747701 7:52427395-52427417 CACGCCCAGCTAATTTTTGTTGG + Intergenic
1025114196 7:56243686-56243708 CACGCCTGGCTAATTTTTTTTGG - Intergenic
1025871168 7:65435505-65435527 CATGCCCGGCTAATTGTTTTTGG - Intergenic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025923522 7:65937548-65937570 TACATCCAGCTAATTTTTTTTGG + Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026195032 7:68165309-68165331 CACGCCTGGCTAATTTTGTAGGG - Intergenic
1026550085 7:71360779-71360801 CATACCCAGCTAATTTTTGTGGG - Intronic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026689024 7:72536421-72536443 CATGCCCAGCTAACTTTTGTAGG - Intergenic
1026724253 7:72858307-72858329 CACGCCCAGCTAACTTTTGTAGG - Intergenic
1026760723 7:73123912-73123934 CACGTCCAGCTAATTTTTGTGGG + Intergenic
1026799812 7:73392884-73392906 CACACCTGGCTAATTTTGTGGGG + Intergenic
1026814233 7:73497084-73497106 CACACCCAGCTAATTTTTGTAGG - Intronic
1026840210 7:73666583-73666605 CACGCCCGGCTAATTTTTGTTGG + Intergenic
1026945088 7:74310866-74310888 CATGCCCTGCTAATTGTTTTTGG + Intronic
1026996501 7:74620212-74620234 CATGCCTGGCTAATTTTTTTGGG - Intergenic
1027037067 7:74932707-74932729 CACGTCCAGCTAATTTTTGTGGG + Intergenic
1027086497 7:75268740-75268762 CACGTCCAGCTAATTTTTGTGGG - Intergenic
1027148684 7:75716808-75716830 CACGCCCAGCTTTTTTTTAGGGG + Intronic
1027234949 7:76292579-76292601 CATGCCCGGCTAATTTTTGTAGG + Intergenic
1027260412 7:76460985-76461007 CACGCCCGGCTAGTTTTTTTTGG + Intergenic
1027527556 7:79289303-79289325 CCCTCCCAGTTAATTTTTAGTGG - Intronic
1027613718 7:80394618-80394640 CAGGCCTGGCTAATTTTTTTTGG - Intronic
1027646685 7:80810100-80810122 CTCGCCCACGTATTTTTTTGTGG - Intronic
1027787586 7:82599500-82599522 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1027873415 7:83739296-83739318 CACGCCCGGCTAATATTTTCTGG - Intergenic
1028548908 7:92034655-92034677 CACACCCAGCTAATTTTTGTGGG + Intronic
1029000875 7:97152804-97152826 CATGCCCAGCAAATTTTTGTAGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029390086 7:100269249-100269271 CACGCCTGGCTAATTTTGTGTGG - Intronic
1029392798 7:100286755-100286777 CACGTCCAGCTAATTTTTGTGGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1029524115 7:101084869-101084891 CACGGCTAGCGAATTTTTTATGG + Intergenic
1029589941 7:101500662-101500684 CACGCCCAGCTAATTTTTGTGGG - Intronic
1029591792 7:101511834-101511856 CATGCCCAGCTAATTTTGGGGGG - Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1029715435 7:102322898-102322920 CACGCCTAGCTAATTTTTTTTGG + Intergenic
1029966269 7:104743992-104744014 CACACCCTGCAAATTTTTTTTGG + Intronic
1029983896 7:104903755-104903777 AATGCCCAGCCAATTTTTTATGG + Intronic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030090467 7:105853605-105853627 CACGCCCAGCTCATTTTTGTGGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1030564618 7:111137979-111138001 CACACCCAGCTAATTTTTGTGGG + Intronic
1031443754 7:121825734-121825756 CACACCCGGCTAATTTTTTTTGG + Intergenic
1031586577 7:123537975-123537997 CATTAGCAGCTAATTTTTTGTGG - Exonic
1032111411 7:129079065-129079087 CACACACAGCTAATTTTTTAAGG - Intergenic
1032142848 7:129349489-129349511 CACGCCTGGCTAATTTTTGTGGG - Intronic
1032182717 7:129694519-129694541 CATGCCTGGCTAATTTTTTTTGG + Intronic
1032201049 7:129823304-129823326 CATGCCCAGGTAATTATTTGGGG - Intergenic
1032234632 7:130109377-130109399 CATGCCTGGCTAATTTTTTTTGG + Intronic
1032277034 7:130466930-130466952 CATGCCTGGCTAATTTTTGGGGG + Intergenic
1032376822 7:131428012-131428034 CATGCCCAGCTAACTTTTTTTGG - Intronic
1032846036 7:135752832-135752854 CCCGCCTGGCTAATTTTTTTTGG + Intergenic
1032871307 7:135988902-135988924 CACGCCTGGCTATTTTTTTTTGG + Intergenic
1032905660 7:136361524-136361546 CACACCTGGCTAATTTTTTGTGG + Intergenic
1033105713 7:138520531-138520553 TTTGCCCAGCTAATTTTTTGTGG - Intronic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1033556052 7:142489289-142489311 CACACCCAGCTAATTCTTTTTGG + Intergenic
1033714380 7:143984646-143984668 CGCGCCCAGCTAATTTTTAGTGG - Intergenic
1033928086 7:146488783-146488805 CACGCCTGGCTAGTTTTTTGTGG + Intronic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1034512841 7:151550323-151550345 CATGCCCAGCTAATTTAATGTGG - Intergenic
1034614014 7:152398981-152399003 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1035160859 7:156949349-156949371 CACGCTCAGCTAATTTTTGTAGG + Intergenic
1035215065 7:157359660-157359682 CACACCCAACTATTTTTTTTTGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035848639 8:2891777-2891799 CACGCCCAGCTAATTTTTGTAGG + Intergenic
1036008562 8:4694510-4694532 CATGCCAGGCTAATTTTTTTTGG + Intronic
1036144619 8:6243516-6243538 CATACCCAGCTAATTTTCTGTGG - Intergenic
1036164830 8:6422843-6422865 CACGCCCGGCTAATTTTTTGTGG + Intronic
1036181814 8:6592306-6592328 CACACCCGGCTAATTATTTTTGG + Intronic
1036615551 8:10384843-10384865 AACACCCAGCTAATTTTTTTTGG - Intronic
1036928799 8:12932486-12932508 CACGCGCGGCTATTTTTTTTTGG - Intergenic
1037647945 8:20810731-20810753 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1037894872 8:22645323-22645345 CACGCCCGGCTAATTTTTGGTGG - Intronic
1037959758 8:23087608-23087630 CACGCCTAGCTAATTTTTGTAGG - Intronic
1037971117 8:23172647-23172669 CACGCCCGGCTAATTTTTTATGG - Intergenic
1038272376 8:26085804-26085826 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1038546925 8:28432902-28432924 CACGCCCCGCTAAATTTCTTTGG - Intronic
1038563975 8:28604333-28604355 CACGCCAAGCTAATTTTTATGGG + Intronic
1038579985 8:28739481-28739503 CACACCTGGCTAATTTTTTTTGG + Intronic
1038731847 8:30135034-30135056 CACGCCTAGTTAATTTTTGTGGG + Intronic
1038812231 8:30860276-30860298 CGTGCCCAGCTAATTTTTGTAGG + Intronic
1039060773 8:33570605-33570627 CATGCCTGGCTAATTTTCTGGGG + Intergenic
1039335706 8:36586976-36586998 CATGCCAAGCTATTTTTTGGTGG - Intergenic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1039865419 8:41496962-41496984 CATGCCCGGCTAATTTTTTTTGG + Intronic
1040030154 8:42816467-42816489 CATGCCTAGCTAATTTTTTTGGG - Intergenic
1040428121 8:47309880-47309902 CATGTCCGGCTAATTTTTTTTGG - Intronic
1040472336 8:47744720-47744742 CATCCCCAGCTAATTTTCTTTGG - Intergenic
1040651984 8:49459215-49459237 CACACCCGGCTAAGTTTTTTTGG - Intergenic
1040789628 8:51211091-51211113 CATGCCCGGCTACTTTTTTTTGG - Intergenic
1040917734 8:52580701-52580723 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1041061519 8:54039401-54039423 CACGCCCGGCTAATATTTTGTGG + Intergenic
1041441283 8:57899520-57899542 CACACCTAGCTAATTTATTTTGG - Intergenic
1041492250 8:58446951-58446973 CATGCCCAGCTAATTTTTTCTGG + Intronic
1041779561 8:61562795-61562817 CACGCCAAGGTCATTTTTTAAGG + Exonic
1042532384 8:69829519-69829541 CGTGCCCAGCTAATTTTTTGTGG - Intronic
1042717506 8:71790546-71790568 CACACCCCGCTAATTTTTTGTGG - Intergenic
1042905194 8:73765501-73765523 CATGCCCAGCTAATTTTTGTGGG + Intronic
1042914772 8:73864731-73864753 CATGTCCAGCAAATTTTTTTGGG + Intronic
1043388506 8:79769518-79769540 CATGCTCAGCTAATTGTTTTTGG + Intergenic
1043503507 8:80879391-80879413 CACGCTCAGCTAGTTTTTGGGGG + Intergenic
1043525073 8:81087705-81087727 CAAGCCCAGCTAATGTTTCGGGG + Intronic
1044212900 8:89571545-89571567 CACGCCCGGCTAATTTTTGGTGG + Intergenic
1044321858 8:90811102-90811124 CATGCCCGGCTAATTTTTTGGGG + Intronic
1044453256 8:92363006-92363028 CACGCCCAGCTAATTAGATCAGG + Intergenic
1045018068 8:98016214-98016236 CACACCAGGCTAATTTTTTGTGG - Intronic
1045220073 8:100190154-100190176 CACATCCAGCTAATTTTTTTTGG - Intronic
1045914782 8:107454922-107454944 CAAGCCCAGGCAATGTTTTGAGG - Intronic
1046121700 8:109855631-109855653 GACTCCCAGCTAATCTTTTCAGG - Intergenic
1046477456 8:114765400-114765422 CATGCCCAGCTAATTATTTTTGG - Intergenic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1046755644 8:117970457-117970479 CATGCCTGGCTAATTTTTTTTGG + Intronic
1046899661 8:119510236-119510258 CAAGCCTAGCTAGTGTTTTGAGG + Intergenic
1047395316 8:124492478-124492500 CACACCCAGCCAATTTTTTGGGG - Intronic
1047702941 8:127468492-127468514 CACTCCCAGCTAATTTTTGTTGG - Intergenic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048338547 8:133521288-133521310 CACACCCAGCTAATTTTTGGGGG + Intronic
1048652794 8:136498011-136498033 CACACCCAGCTAAATTTTTAGGG - Intergenic
1048754948 8:137728155-137728177 CACGCCAGACTAATTTTTTTTGG + Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049108829 8:140630110-140630132 CACGCCCATCAGATTTTCTGAGG + Intronic
1049186181 8:141255246-141255268 TACACCCAGCTAATTTTTCTAGG + Intronic
1049430507 8:142560994-142561016 CCTGCCCAACTAATTTTTTAAGG + Intergenic
1049569990 8:143365089-143365111 CACGGCCAGTTAAATTCTTGGGG + Intergenic
1051423706 9:16913995-16914017 CATGCCAGGCTAATTTTTTGTGG + Intergenic
1051495526 9:17718569-17718591 CATGCCCAGCTAATTTTTGTGGG - Intronic
1051627661 9:19113728-19113750 CATGCCCAGCTAATTTTTGTGGG + Intronic
1051641442 9:19228551-19228573 CACACCCCACTAATTTTTTGGGG - Intergenic
1051887355 9:21907399-21907421 CATGCCCAGCTAATTTTTGTAGG - Intronic
1051948571 9:22602406-22602428 CATGACCGGCTAATTTTTTTTGG - Intergenic
1052415485 9:28171863-28171885 CACGCCTGGCTAAATTTTTTTGG - Intronic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1052728011 9:32253251-32253273 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1053119156 9:35532587-35532609 CACACCCAGCTATATTTTTGTGG - Intronic
1053194361 9:36104491-36104513 CACGCCCAGCTAAATTTGAGGGG + Intronic
1053394148 9:37757238-37757260 CATGCTCATCTAATTCTTTGTGG + Intronic
1053444239 9:38139452-38139474 CATGACTAGCTAATTTTTTGTGG + Intergenic
1053611337 9:39716135-39716157 CACACCCGGCTAATTTTTTTAGG + Intergenic
1053797113 9:41736648-41736670 CATACCCGGCTAATTTTTTTTGG + Intergenic
1054086917 9:60755025-60755047 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054139942 9:61519692-61519714 CACGCCTGGCTAACTTTTTTTGG - Intergenic
1054148084 9:61578220-61578242 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054185527 9:61948729-61948751 CATACCCGGCTAATTTTTTTTGG + Intergenic
1054242183 9:62626257-62626279 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054467824 9:65509314-65509336 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054751486 9:68911724-68911746 CACACCTGACTAATTTTTTGTGG - Intronic
1054781163 9:69167082-69167104 CACGCCCAGCTAATTTTTCTGGG - Intronic
1054849146 9:69828524-69828546 CACACCCGGCTAATTTTTGGTGG - Intronic
1054986860 9:71271654-71271676 CAGGCCCAGCGAATCCTTTGTGG - Intronic
1054995663 9:71385859-71385881 CACACCTGGCTAATTTTTTTTGG + Intronic
1055018127 9:71641175-71641197 CACACCCAGCTAATTTTTGTAGG - Intergenic
1055219499 9:73911196-73911218 CATGCCAAGCTAATTTTTTGGGG - Intergenic
1055279660 9:74659645-74659667 CACACCTGGCTAATTTTTTGTGG + Intronic
1055305326 9:74923514-74923536 CATGCTCTGCTAATTTTTTAAGG - Intergenic
1056065335 9:82927716-82927738 CATGCCCGGCTAATTTATTATGG - Intergenic
1056368852 9:85934098-85934120 CACACCTGGCTACTTTTTTGGGG - Intergenic
1056993523 9:91432448-91432470 CAGGCCCAGCCAATTTCTTTCGG + Intergenic
1057109591 9:92455231-92455253 TGTGCTCAGCTAATTTTTTGTGG - Intronic
1057596887 9:96422199-96422221 CATGCCCAGCTAATTGTTTTTGG - Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1058454076 9:105123159-105123181 CACACCCAGCTAATTTTTGGTGG - Intergenic
1058660800 9:107266790-107266812 CACACCTGGCTTATTTTTTGTGG + Intergenic
1058854000 9:109041972-109041994 TATGCCTGGCTAATTTTTTGTGG - Intronic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059226367 9:112676545-112676567 CACACCTGGATAATTTTTTGTGG - Intergenic
1059298771 9:113296436-113296458 CACGCCCAGCTAATCTTTGCTGG + Intergenic
1059914700 9:119085971-119085993 CACACCCAGCTAATTTTTGTGGG - Intergenic
1060227264 9:121800644-121800666 CATGTCCAGCTAATTTTTCTGGG + Intergenic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1060500225 9:124147896-124147918 CACGTCTGGCTAATTTTTTTTGG - Intergenic
1060689399 9:125643189-125643211 CACGCCCAGCGTTTTTTTTTTGG + Intronic
1060734210 9:126055986-126056008 CACGACCTGCTAGTTTTTTGTGG - Intergenic
1061096852 9:128462754-128462776 CATGCCCGGCTAATTTTTTATGG + Intronic
1061131591 9:128711587-128711609 CACGCCCGGCCTTTTTTTTGGGG + Intronic
1061562312 9:131413530-131413552 CACACCCAGCTAATTTTTAGTGG + Intronic
1061616942 9:131786620-131786642 CATGCCTAGCTAATTTTTTGTGG + Intergenic
1061690255 9:132321689-132321711 CACACCCGGCTAATTTTTGTGGG - Intronic
1061827033 9:133264909-133264931 CACATCTAGCTGATTTTTTGTGG + Intronic
1061857557 9:133450590-133450612 CACGCCAGGCTAATTTTTGTGGG - Intronic
1061870819 9:133519401-133519423 GACACCCACCGAATTTTTTGTGG - Intronic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1185840646 X:3386948-3386970 CACACCAGGCTAATTTTTGGGGG + Intergenic
1185987519 X:4852420-4852442 CACGCCCGGCTAACTTTTTCAGG + Intergenic
1186459531 X:9737164-9737186 CACACCCTGCTAATTTTCTTTGG - Intronic
1186492775 X:9987133-9987155 CACGCCCAGCTAGATTGTTCTGG + Intergenic
1186821400 X:13291503-13291525 CACGCCCGGCCAAGTTTTTGAGG - Intergenic
1187009749 X:15267255-15267277 CACGCCTGGCTAATTTTTTGGGG - Intronic
1187057820 X:15757549-15757571 CATGCCCGGCTAATTTTTGTGGG - Intronic
1187138263 X:16569442-16569464 CATGCTCAGCTAATTTTTTAAGG - Intergenic
1187153522 X:16703179-16703201 CACGCCCTGCTAATTTTTGTGGG + Intronic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1187871765 X:23770645-23770667 CATGCTCAGCTAAATTTTGGTGG + Intergenic
1188117874 X:26267430-26267452 CACACCCAGCTAATTGTTTTTGG - Intergenic
1188304543 X:28546370-28546392 CACGCCTGGCTAATTTTTGTGGG + Intergenic
1188536463 X:31202026-31202048 CATGCCTGGCTAATTTTTTGTGG - Intronic
1188674204 X:32918505-32918527 CACACACAGCTAATTTTTGTGGG + Intronic
1189151302 X:38710122-38710144 CATGCCTAGCTAATTTTTGTGGG + Intergenic
1189275476 X:39782130-39782152 CAAGCCCAGCTAATGTTTTTTGG + Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1189376178 X:40467801-40467823 CATACCCGGCTAATTTTTTTTGG + Intergenic
1189440551 X:41031915-41031937 CACACCTGGCTAATTTTTTTTGG - Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190053151 X:47166623-47166645 CATGCCCAACTAATATGTTGTGG + Intronic
1190158819 X:48015862-48015884 CACACCCAGCTAATATTTTCTGG - Intronic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190174518 X:48138141-48138163 CACACCCAGCTAATATTTTCTGG - Intergenic
1190196991 X:48328405-48328427 CACGCCCCGCTGATTTTTTTAGG + Intergenic
1190663724 X:52678784-52678806 CACGCCCCACTGATTTTTTTAGG + Intronic
1190675699 X:52779638-52779660 CACGCCCCACTGATTTTTTTAGG - Intronic
1190710836 X:53068623-53068645 CATGCCTGGCTAATTTTTTAAGG - Intronic
1190789940 X:53689220-53689242 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1191603378 X:63034661-63034683 TACACCCAGCTAATTTTTTTTGG - Intergenic
1191862026 X:65673609-65673631 CATGCCCAGCTAATTTTGTATGG + Intronic
1192783714 X:74318441-74318463 CCCACCCAGCTAATTTTTGTGGG - Intergenic
1193107894 X:77699288-77699310 CACACCTGGCTAATTTTTTGTGG + Intronic
1193529457 X:82638796-82638818 CACACCTGGCTAATTTTTTGGGG + Intergenic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1193913861 X:87341380-87341402 CATGCCCAGCTAATATTTTTGGG - Intergenic
1194371833 X:93083235-93083257 CACACACAGCTAAATTTTTTTGG + Intergenic
1195091494 X:101463908-101463930 CATGCCCGGCTAATTTTTTTTGG + Intronic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1196789793 X:119453688-119453710 CACACCTAGCTAATTTTTTGGGG + Exonic
1196908263 X:120460114-120460136 CAAGCCCAGCAAATTTTTAGTGG - Intronic
1197305308 X:124834326-124834348 CACGCCCGGCTAATTTTTGTAGG + Intronic
1197728086 X:129789478-129789500 CACGCCTGGCTAATTTGTTTTGG - Intronic
1197780747 X:130157792-130157814 CCTGCCCAGCTAATTTTTAACGG - Intronic
1197859579 X:130956238-130956260 CACGCCCGGCTAATTTTTTGTGG - Intergenic
1197932476 X:131710122-131710144 CGTGCCCAGCTAATTTTGTGGGG + Intergenic
1198207204 X:134478260-134478282 CACACCCATCTATTTTTTTTTGG + Intronic
1198261772 X:134971131-134971153 CACACCCAGCTTTTTTTTGGGGG - Intergenic
1198462457 X:136876862-136876884 CACACCCAGCTAATTTTTGGTGG + Intronic
1198751460 X:139940260-139940282 CATGCCCGGCTAATTTTTGTAGG - Intronic
1198889740 X:141380337-141380359 TGCGCCCGGCTAATTTTTTTTGG - Intergenic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199255126 X:145710708-145710730 CACACCCAGCTGAATTTTTTTGG - Intergenic
1199591865 X:149475267-149475289 CAAGCCTGGCTAATTTTTTTTGG + Intergenic
1199756278 X:150867923-150867945 CACGCCCAGCTAATTTTTGTAGG - Intronic
1199876421 X:151932388-151932410 CACGCCTAGCTAATTTTGTTTGG + Intergenic
1200679876 Y:6197269-6197291 CACACACAGCTAAATTTTTTTGG + Intergenic
1200780546 Y:7211536-7211558 CAGGCCTGGCTAATTTTTTGTGG - Intergenic
1201055488 Y:9985979-9986001 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1201497194 Y:14601256-14601278 CTCGCCCACCTAATTTTTGGTGG + Intronic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic
1201904545 Y:19076332-19076354 CATGCCTAGCTAAATTTTTTTGG - Intergenic
1202027809 Y:20542842-20542864 CTAGCCCAGCCAATTTTTTCTGG - Intergenic