ID: 1046538222

View in Genome Browser
Species Human (GRCh38)
Location 8:115544231-115544253
Sequence GCCTGAAGAAGGCAAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046538222_1046538225 -5 Left 1046538222 8:115544231-115544253 CCAGCCACTTGCCTTCTTCAGGC 0: 1
1: 0
2: 3
3: 33
4: 280
Right 1046538225 8:115544249-115544271 CAGGCCTCATTTGCCTTATCAGG No data
1046538222_1046538228 2 Left 1046538222 8:115544231-115544253 CCAGCCACTTGCCTTCTTCAGGC 0: 1
1: 0
2: 3
3: 33
4: 280
Right 1046538228 8:115544256-115544278 CATTTGCCTTATCAGGGAAATGG No data
1046538222_1046538229 3 Left 1046538222 8:115544231-115544253 CCAGCCACTTGCCTTCTTCAGGC 0: 1
1: 0
2: 3
3: 33
4: 280
Right 1046538229 8:115544257-115544279 ATTTGCCTTATCAGGGAAATGGG No data
1046538222_1046538226 -4 Left 1046538222 8:115544231-115544253 CCAGCCACTTGCCTTCTTCAGGC 0: 1
1: 0
2: 3
3: 33
4: 280
Right 1046538226 8:115544250-115544272 AGGCCTCATTTGCCTTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046538222 Original CRISPR GCCTGAAGAAGGCAAGTGGC TGG (reversed) Intronic
902423808 1:16303384-16303406 ACATGAAGTAGGCAAGGGGCAGG - Intronic
902601270 1:17541126-17541148 GCCTCAGGAAGGCAAGCGCCTGG - Intronic
902795174 1:18796183-18796205 CCCTGGAGAAGGCAAGTGACTGG - Intergenic
903367929 1:22816392-22816414 GTATGAAGAAGGCAGGAGGCAGG - Intronic
904620755 1:31773644-31773666 GCCAGAAGCAGGCAAGGGTCAGG + Intergenic
905197468 1:36291553-36291575 GCCTGAAGCAGGCCAGGGTCTGG - Intronic
906204845 1:43981268-43981290 GGCTGAAGAAGGCCAGGTGCTGG - Exonic
906401863 1:45510255-45510277 AGCTGAGGAAGACAAGTGGCTGG + Exonic
906953445 1:50352579-50352601 GCCTGAAGAATGTAGGGGGCTGG - Intergenic
908811970 1:67990926-67990948 GCCTAAAAATGGCAAGTGGCTGG + Intergenic
908828866 1:68159569-68159591 GCCTGTAGAAGCCACGTGGAAGG + Intronic
910843914 1:91587311-91587333 GGCTGAAGGAGGGAACTGGCAGG - Intergenic
913141689 1:115947498-115947520 GCCTGTGGAAGCCAAGTGCCTGG + Intergenic
913263797 1:117024982-117025004 GGCTAAAGAAGGAAAGAGGCTGG + Intronic
913957728 1:143320005-143320027 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
914052038 1:144145369-144145391 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
914127159 1:144821172-144821194 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
914899957 1:151706557-151706579 GCCTGAAGAGGGTGATTGGCAGG + Intronic
916429693 1:164715521-164715543 TCCTGAAGAAGGGAAGAGACAGG + Intronic
916850057 1:168694635-168694657 CCATGAAGAAAGCAAATGGCTGG - Intergenic
918164941 1:181936128-181936150 GTCTGGAGAAGGTTAGTGGCTGG - Intergenic
919741600 1:200984421-200984443 GCCTGAGGAAGGCAATTTGGGGG + Intronic
921152353 1:212412582-212412604 CTCTGAAGAAGGCAAGGGGAGGG + Intronic
922044088 1:221926911-221926933 GCCTGAAGCAAGTAAGTGGAAGG + Intergenic
923210469 1:231799666-231799688 GCCTGGAGAAGGCAGGAGGCAGG + Intronic
923325871 1:232879579-232879601 GCTTTAAAAAGGCAAATGGCGGG + Intergenic
924552354 1:245090273-245090295 GCCCTAAAAGGGCAAGTGGCTGG + Intronic
924697906 1:246419380-246419402 GGTGGAAGAAGACAAGTGGCCGG - Intronic
1063151275 10:3338671-3338693 GTCAGAAGATGGAAAGTGGCAGG + Intergenic
1066332023 10:34434081-34434103 AGCTGAAGGAGGCAGGTGGCAGG + Intronic
1066463573 10:35633687-35633709 GGCTGTAGAAGGCAAAAGGCAGG + Intergenic
1066759939 10:38740572-38740594 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1066961678 10:42232197-42232219 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
1068913618 10:62405259-62405281 GCCTGAAGAAGGCACGATGCTGG - Intronic
1070782121 10:79143740-79143762 CCCTGAACAAGGCCAGAGGCCGG + Intronic
1071272224 10:84018699-84018721 CCCTCAAGAATGAAAGTGGCAGG + Intergenic
1072295971 10:94009882-94009904 GCTTGAAGAGTGCAAGTTGCTGG + Intronic
1074406943 10:113187904-113187926 GCCTAAAGAAGTCCAGTGTCAGG + Intergenic
1075646960 10:124102985-124103007 GCCAGAACAGGGCAGGTGGCAGG - Intergenic
1075845172 10:125539545-125539567 TCAGGAAGAAAGCAAGTGGCTGG - Intergenic
1076197422 10:128529281-128529303 GCATGAAGGAGGCAAGTGCCTGG - Intergenic
1076549871 10:131271433-131271455 GCCCACAGAAGGCACGTGGCTGG + Intronic
1077349956 11:2088425-2088447 GCCTGAAGGAGGCGTGTGGGAGG - Intergenic
1078011747 11:7577628-7577650 GGCTGAAGAGGGTAAGTGACTGG + Intronic
1080446919 11:32345962-32345984 GCCTGAAGAAGGCAGGTGGAAGG - Intergenic
1083188633 11:61033751-61033773 GCTTGAGGAAGGCGAGTAGCAGG + Intergenic
1083638075 11:64130936-64130958 GCCTCAAGAAGAGAACTGGCCGG + Intronic
1084084826 11:66850152-66850174 ACCTCAAGGAGGCCAGTGGCAGG + Intronic
1085297749 11:75440437-75440459 GCATGCAGAAGGCAGGTGGAGGG - Intronic
1088329449 11:108635140-108635162 GCCAGAAGAAGGCATGTGAATGG + Intergenic
1089346895 11:117796708-117796730 GCAGGAAGAGGGCAAGGGGCTGG + Intronic
1089401972 11:118169536-118169558 GCCTGAGGAAGGTAGGGGGCTGG - Intronic
1089795666 11:120978653-120978675 GCCTGAACTAGGGAAGTGGCAGG + Intronic
1090203338 11:124871099-124871121 GCCAGAAGATGGCAGGTGGGGGG - Exonic
1090438015 11:126702942-126702964 GCCAGAAGAAAGCATGTAGCTGG - Intronic
1092907715 12:13117035-13117057 GCCTGAAGAAGAAAAGACGCAGG - Intronic
1094715707 12:33013065-33013087 GCCTGAGAAAGGAATGTGGCTGG + Intergenic
1095099494 12:38165800-38165822 GCCTGAAAATGGCAAGTCCCAGG - Intergenic
1096095709 12:48934295-48934317 GCCTGTAGAAAGCCAGTGGAAGG - Intronic
1096105724 12:48996175-48996197 GCCTGGAGAGGGAAAGTGACTGG + Exonic
1097258159 12:57696254-57696276 GCCTGGAGAAGACATGAGGCAGG - Exonic
1098754372 12:74340338-74340360 GATTGAAGCAGGCAAGTGTCTGG - Intergenic
1101536035 12:105617495-105617517 TCTTCAAGAAGTCAAGTGGCAGG + Intergenic
1101733203 12:107443517-107443539 CCCTGAGGTAGGCATGTGGCAGG + Intronic
1101875449 12:108594006-108594028 GCCCGGAGAAGGCAAAGGGCAGG + Intronic
1102236847 12:111298977-111298999 GCCGGAGGAAGGCAGGAGGCGGG - Intronic
1102613191 12:114130533-114130555 AACTGAAGAAGGAAAATGGCAGG - Intergenic
1103340537 12:120218990-120219012 GCCTCAACAAGGCAAGAGGTGGG + Intronic
1104233879 12:126912642-126912664 CCCTGAAGGAGGAAAATGGCAGG + Intergenic
1104376790 12:128270106-128270128 GCCTGTATAAAGCAAGTGGAAGG + Intronic
1105437292 13:20390185-20390207 GGCTGGAGAAGGGAATTGGCAGG + Intergenic
1113984701 13:114304253-114304275 GCCTGAAGAAGGCAACAGCCAGG - Intronic
1116864847 14:50023642-50023664 GACTGAAGAAGGCAAGTGAAGGG + Intergenic
1117983373 14:61363742-61363764 GGATGAAGAAGGCAACGGGCAGG + Intronic
1118161712 14:63297464-63297486 GCCTGGAGAAGGCAATTTTCTGG - Intergenic
1121048058 14:90802330-90802352 GCCTGCAGAAGGGAAGGGTCAGG + Intronic
1122887257 14:104715596-104715618 GCCTCGAGAGGGCAGGTGGCAGG + Intronic
1123063438 14:105604817-105604839 ACCTGGAGAAGGCAGGGGGCTGG - Intergenic
1123087500 14:105723603-105723625 ACCTGGAGAAGGCAGGGGGCTGG - Intergenic
1202930657 14_KI270725v1_random:30085-30107 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1123421700 15:20141332-20141354 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
1123530926 15:21147872-21147894 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
1123799889 15:23808721-23808743 GCCGGTAGGAGGCAAGTGGAGGG + Intergenic
1124650412 15:31469702-31469724 GGCTGCAGAAGGGAGGTGGCTGG - Intergenic
1125114125 15:36067982-36068004 GCGTTAAGAAGGCAGGGGGCTGG + Intergenic
1126480206 15:49110735-49110757 GCCAGCAGAAAGCAGGTGGCTGG - Intronic
1127085220 15:55418132-55418154 TCCTGAAAAAGGGAAGTGGGTGG + Intronic
1127639714 15:60904783-60904805 GACGGAAGAAGGCTGGTGGCTGG + Intronic
1127691876 15:61404556-61404578 GACTGAAGAAGACAAGGGGGAGG - Intergenic
1128682812 15:69663869-69663891 GGCTGAGGAAGGCCAGAGGCAGG - Intergenic
1128750817 15:70147813-70147835 GGCTGAAGAAGGGCAGTGGGTGG + Intergenic
1132336415 15:101051135-101051157 GCATGAAGCAGGCAGTTGGCCGG + Intronic
1132948910 16:2549295-2549317 GCCTGCAGAAAGCAGGTGCCTGG - Intronic
1132965677 16:2652832-2652854 GCCTGCAGAAAGCAGGTGCCTGG + Intergenic
1133984781 16:10660287-10660309 GCCTGCCCAAGGCAGGTGGCAGG + Intronic
1135253841 16:20924372-20924394 GCCTGTAGAAGGAAAGCGGAAGG + Exonic
1135326246 16:21527503-21527525 GCCAGAGGAAGGCACTTGGCTGG - Intergenic
1135492799 16:22924396-22924418 GCCTTGAGAAGTCAAGTGGAAGG - Intergenic
1136722863 16:32338705-32338727 GCCTGAAGATGGGAAGGGCCGGG - Intergenic
1137618409 16:49859666-49859688 GCCAGAAGTAGGCAGGTGGGGGG - Intergenic
1137783124 16:51114519-51114541 GCCAGAAGAAAGCCAGGGGCAGG + Intergenic
1139662979 16:68434938-68434960 GCCTGGAGCAGGAGAGTGGCAGG + Intronic
1139959892 16:70711391-70711413 GCCTCAAGAAGGCAAGTGTCAGG - Intronic
1141161287 16:81630696-81630718 GGATGAAGCAGGCAGGTGGCTGG - Intronic
1203003568 16_KI270728v1_random:179059-179081 GCCTGAAGATGGGAAGGGCCGGG + Intergenic
1203135176 16_KI270728v1_random:1715466-1715488 GCCTGAAGATGGGAAGGGCCGGG + Intergenic
1142578467 17:925269-925291 GCCTGAACAAGTCCAGTGACGGG + Intronic
1143159674 17:4860960-4860982 GCCTGAGGCAGGCAAGGGGAGGG - Intronic
1143611509 17:8020458-8020480 GCCTGAAGAGGGGAAGTGGCCGG + Intergenic
1143660514 17:8321896-8321918 GACTGAAGATGGCCAGTAGCTGG + Exonic
1146318289 17:31826292-31826314 GCAGGAAGAAGGCAAGGGGATGG + Intergenic
1146352996 17:32111510-32111532 GCCTGAAGGCGGCAGGTGGTGGG + Intergenic
1148333974 17:46829500-46829522 GACTGTAGGAGGCAGGTGGCTGG - Intronic
1149909552 17:60554489-60554511 GTCTTAAGAAAGAAAGTGGCTGG + Intergenic
1150328300 17:64274361-64274383 GCCTGAAGAAGCCAAGTCTCTGG + Intergenic
1151640629 17:75390220-75390242 AGCTGAAGAAAGCAAGAGGCTGG + Intronic
1151738198 17:75959589-75959611 GCATGAAGAAAGCAGGTGGGGGG + Intronic
1151850262 17:76685753-76685775 GCCTGAAGAGGGCACATGGATGG + Intronic
1153322256 18:3784899-3784921 GCAGCAAGAAGGCCAGTGGCTGG - Intronic
1154492643 18:14933438-14933460 GCCTGCAGAGAGCAAGGGGCAGG + Intergenic
1155152973 18:23136503-23136525 GCCTGGAGAAGGCGATGGGCAGG - Exonic
1155720189 18:29001715-29001737 GACTGAAGATGGCAGGTGACAGG - Intergenic
1157330672 18:46701573-46701595 GCAAGAAGAAGGCCATTGGCAGG + Intronic
1157898587 18:51491801-51491823 GCCCTAGGAAGGCAAGTTGCTGG + Intergenic
1158480989 18:57821709-57821731 GCCTCAAGAAGGTAGGTGGCAGG - Intergenic
1160232546 18:77058799-77058821 GCCTGGAGAAGGCCACTGCCAGG + Intronic
1160844004 19:1158756-1158778 ACCTGAAGATGGCAAGGAGCAGG + Intronic
1161006047 19:1937327-1937349 GCAGGAAGAAGACACGTGGCTGG + Intergenic
1162344310 19:10110714-10110736 GCATGAAGAAGGCACGGGTCGGG + Exonic
1162831706 19:13288663-13288685 ACCTGTAGATGGCAAGAGGCAGG - Intronic
1162986956 19:14277066-14277088 GTTTGAAGAGAGCAAGTGGCAGG - Intergenic
1163642759 19:18470753-18470775 GCCTTAAGAGGGAAACTGGCTGG + Intronic
1163835531 19:19571216-19571238 TACTGATAAAGGCAAGTGGCAGG + Intronic
1164578910 19:29422297-29422319 CCCTGAAGAAGGCAGCTGGGGGG - Intergenic
1164644484 19:29848246-29848268 GTCAGAAGAAGGCAAGGGGAAGG + Intergenic
1164750275 19:30648512-30648534 TCCTGCAGAAGGCCAGTAGCTGG - Intronic
1166337486 19:42117119-42117141 GACAGAAGAGGGCAAGAGGCAGG + Intronic
1167347583 19:48955860-48955882 TCCTGAAGGAGCCCAGTGGCTGG - Intronic
1167853477 19:52219795-52219817 GGCTGAGGACGCCAAGTGGCGGG + Exonic
1168105182 19:54162090-54162112 ACCTGAAGAAGGTAAGGGGTAGG - Exonic
1168183170 19:54677468-54677490 GGCTGGAGGAGGCAAGTGTCTGG - Intronic
1168340387 19:55619828-55619850 GAATGAAGAGGGCAGGTGGCCGG + Intergenic
1202691437 1_KI270712v1_random:97793-97815 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
927884162 2:26708246-26708268 GCCTCAAGCAGGCCAGTGCCAGG + Intronic
928324548 2:30309221-30309243 TCCTGCAGGAGCCAAGTGGCTGG + Intronic
929599590 2:43196862-43196884 GCAGGAAGAAGGAAAATGGCAGG - Intergenic
933954954 2:87356157-87356179 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
934239143 2:90252371-90252393 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
934274040 2:91564327-91564349 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
934323262 2:91984912-91984934 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
934461582 2:94215725-94215747 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
934517600 2:94998536-94998558 GGCTGAAGAAGGAAACAGGCTGG - Intergenic
936438399 2:112528768-112528790 GCTTGATGAAGGCAGCTGGCTGG - Exonic
936599727 2:113883951-113883973 GCCTGAAGAAGCCAAGATGCTGG - Intergenic
937343190 2:121104928-121104950 GGCTGGAGAAGGCCTGTGGCTGG + Intergenic
938339760 2:130527599-130527621 GCCTGCAGAAGGCAGGGAGCAGG + Intronic
938350076 2:130593151-130593173 GCCTGCAGAAGGCAGGGAGCAGG - Intronic
938398149 2:130965609-130965631 GTCTGAATAAGGAAAGGGGCAGG - Intronic
938528744 2:132162332-132162354 ACCTGAACATGGCACGTGGCAGG - Intronic
940261834 2:151788928-151788950 GAGGTAAGAAGGCAAGTGGCAGG - Intergenic
940478113 2:154192197-154192219 GACAGAAGAAGATAAGTGGCTGG - Intronic
941065963 2:160903112-160903134 GCATGAAGAAGGCAGATGGCAGG - Intergenic
941645478 2:168035867-168035889 TGCTGAAGAAGGAGAGTGGCAGG - Intronic
944835731 2:203577529-203577551 TACTGAAGAAGGCAAGAGGAAGG - Intergenic
944866395 2:203866646-203866668 GCCTGAAAGAGGCACGTGGAAGG + Intergenic
944926954 2:204475137-204475159 TGCAGAAGGAGGCAAGTGGCTGG - Intergenic
945111070 2:206360409-206360431 GACTGAAGAGGGCAGGAGGCAGG + Intergenic
945941857 2:215958672-215958694 GCCTGAAGAAGGCAGATTGCTGG - Intronic
946324250 2:218975912-218975934 GCTTGGAGAAGTGAAGTGGCTGG - Intergenic
947390504 2:229634830-229634852 GCCAGAAGGGGACAAGTGGCCGG - Intronic
947425606 2:229980552-229980574 GCCTGGAGCAGGCAAGAGACTGG - Intronic
948031399 2:234820625-234820647 GGCTGGAGAAGGCTTGTGGCTGG - Intergenic
948670517 2:239565633-239565655 GCATGAAGAAGGCATGTAGAAGG + Intergenic
948670553 2:239565996-239566018 GCATGAAGAAGGCATGTAGAAGG + Intergenic
948670571 2:239566130-239566152 GCATGAAGAAGGCATGTAGAAGG + Intergenic
948800431 2:240430924-240430946 GCCTGCAGAAGGGCAGTGGGAGG + Intergenic
1168876875 20:1177901-1177923 GCCAGAGGAAGGCCAGAGGCTGG - Intronic
1168969750 20:1922918-1922940 AGGTGAAGAAGGCAAGAGGCAGG - Intronic
1170536831 20:17348979-17349001 GCATGAAGACACCAAGTGGCTGG - Intronic
1171971686 20:31568932-31568954 GCCTGAGGAGGGCATGTGGTAGG + Intronic
1173241797 20:41303559-41303581 GTCTATAGAAGGCAAGGGGCTGG - Intronic
1174048562 20:47751251-47751273 GCCAGAAGAAGGCAGGTAGCTGG - Intronic
1174564210 20:51452968-51452990 GCATTAAGAACGCAGGTGGCAGG - Intronic
1175966928 20:62664473-62664495 GCCTGAAAAAGGGAACTGGCTGG - Intronic
1176592677 21:8658708-8658730 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1176922141 21:14700491-14700513 GCTTCAAGAAGGCAAATGTCAGG - Intergenic
1178275587 21:31233892-31233914 GCCTGAGGAAGGGCAGTGGCAGG + Intronic
1180163622 21:46009104-46009126 GCCTCAAGAAGGCAGGGGGTTGG + Intergenic
1180275532 22:10635850-10635872 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1180550006 22:16530783-16530805 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1181032199 22:20154067-20154089 GCGGGAAGAAGGCAAGCGGCTGG - Intergenic
1181083303 22:20427854-20427876 GGCTGAAGAAGACACCTGGCTGG + Intronic
1181106467 22:20578737-20578759 GACTGCTGAGGGCAAGTGGCTGG - Intronic
1181354664 22:22291031-22291053 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
1181426688 22:22848520-22848542 ACCTGGAGAAGGCAAGTGCCTGG + Intronic
1181440613 22:22933548-22933570 GCTTGAAGAAGACAAGGGGCAGG + Intergenic
1181511260 22:23389664-23389686 GCAGGAAGAAGGCAAGCAGCTGG + Intergenic
1181754612 22:25014773-25014795 GCCTAAAGAAGTCTAGTGGAGGG + Intronic
1182511238 22:30822033-30822055 GCAGGAAGAAGGCAACAGGCAGG - Intronic
1185080565 22:48707354-48707376 GCCAGAAGAAGGCAGGAGGAGGG - Intronic
1185148432 22:49151452-49151474 GCCTGAGGAAGGACAGTGACAGG + Intergenic
950095458 3:10326899-10326921 GCCTGGAGAAGGGAAGGGGCTGG + Exonic
950453596 3:13079431-13079453 ACCAGAAGGAGGCAAGTGGCTGG - Intergenic
950550424 3:13662742-13662764 GCCTGAAGATGGCGTGGGGCAGG - Intergenic
952942562 3:38455055-38455077 GCCTCCAGGAGGCACGTGGCGGG + Intronic
952971483 3:38653575-38653597 GATTGAAGAAGGTAAATGGCTGG + Intergenic
955125083 3:56103245-56103267 GCCTGCAGAATTCAATTGGCAGG + Intronic
955155099 3:56408895-56408917 GCCTGAGGAACGCACGAGGCTGG + Intronic
955598969 3:60623831-60623853 GCCTGAAGAAGCCAGTTGGAGGG + Intronic
958462711 3:94419008-94419030 TCCTGAAGAAGGGCTGTGGCTGG + Intergenic
960869043 3:122230849-122230871 GGCTGAAGAAGTCTAGTGGAGGG - Intronic
962986794 3:140543625-140543647 GCATGGAGAAGGGCAGTGGCAGG - Intronic
963757192 3:149247226-149247248 GCCTGAAGAAAGCATTTGGCGGG - Intergenic
965425476 3:168517551-168517573 GCCAGAAGAAGGCACATGGCAGG - Intergenic
965433001 3:168612420-168612442 GGCGGAAGAAGACAAGCGGCTGG + Intergenic
965752247 3:171988071-171988093 GGATGAAAAAGGCAAGTTGCAGG - Intergenic
966800436 3:183758643-183758665 ACCTGAAGAAGGTAAGAAGCTGG - Intronic
967579214 3:191132333-191132355 GCAAGAAGATGGCAGGTGGCAGG - Intergenic
967868888 3:194213173-194213195 GCCTTAAGAAGGCCGGTGCCAGG + Intergenic
967941716 3:194771525-194771547 GGCAGAAGAAGGTGAGTGGCTGG + Intergenic
969564235 4:7968168-7968190 GGCTGGAGAAGGCCAGTGACAGG + Intronic
970036874 4:11746232-11746254 GGGAGAAGAAGGCAAGTGGAGGG - Intergenic
970444313 4:16111127-16111149 GACTCAAGAAGGAAGGTGGCTGG - Intergenic
976829592 4:89299395-89299417 GCATGAGGAAGGAAAGTGGCAGG + Intronic
980748588 4:137057289-137057311 GCCTGTAGAAGGTAAATGGCTGG - Intergenic
981944330 4:150323668-150323690 TCCTGATGCAGGCAAGTAGCAGG + Intronic
987057918 5:14212593-14212615 GCCTGAGGAAGGCCTGTGGTGGG + Intronic
989229929 5:39074259-39074281 GCCAGGGGAAGGCAAGTGCCAGG + Intronic
991977654 5:72198919-72198941 GCCTGGAGAAGGACAGTGGAGGG + Exonic
993086798 5:83373120-83373142 GCAAGCAGAAGGCAAGTGGAAGG - Intergenic
995536540 5:113142317-113142339 GCCTGAGGACAGCAAGTGGCTGG - Intronic
995899762 5:117052046-117052068 GCCAGAAGAAGGAAATTGACAGG + Intergenic
997009866 5:129863108-129863130 GCCTGGAGAAGGGAGGTGGGAGG + Intergenic
997862515 5:137430867-137430889 GTGTAAAGAAGGCAAGTGGATGG - Intronic
998247999 5:140526471-140526493 GCATGAAGAAGGAAAGGTGCAGG - Intronic
1001050401 5:168409415-168409437 GCCTGCAGATGGCTAGTAGCTGG - Intronic
1001290305 5:170452550-170452572 GCCTGAAGATGGGAAGTGACAGG - Intronic
1001535264 5:172493619-172493641 GCCAGAAGAAGGGAAGGGGCGGG - Intergenic
1001940626 5:175737096-175737118 GCCTGAGGAAGGGAAGGGGTGGG + Intergenic
1003851136 6:10223816-10223838 GACTAAAGAAGTGAAGTGGCAGG + Intergenic
1004537538 6:16517347-16517369 ACATGAAGAGGTCAAGTGGCTGG - Intronic
1004671322 6:17800328-17800350 GACTCCAGAAGGCAAGTTGCAGG - Intronic
1004903410 6:20213477-20213499 TCCTGAAGAAGGCAAGAGTGAGG - Intergenic
1006176000 6:32121983-32122005 GCCTGAGCAGGGGAAGTGGCAGG + Intronic
1006365620 6:33613425-33613447 ACCAGAAGAGGGCAAGGGGCAGG + Intergenic
1007236366 6:40393599-40393621 GCATGAAGGAGGGAAGTAGCGGG - Intronic
1007494880 6:42252851-42252873 TCCTGGAGAAGGCAAGTGACTGG + Intronic
1009034106 6:58095874-58095896 GCTTGAAGAAGGCAGATGGTGGG - Intergenic
1009209714 6:60847579-60847601 GCCTGCAGAAGGCAGATGGTGGG - Intergenic
1009626283 6:66141964-66141986 TCCTGTGGAAGGAAAGTGGCTGG + Intergenic
1015863364 6:137703223-137703245 GCCTGAGGAAGGAGAGTGTCTGG - Intergenic
1017170752 6:151452273-151452295 GCCGGAAGCAGGCAAGGGACCGG - Exonic
1019307803 7:344167-344189 CCCTGCAGAAGCCGAGTGGCTGG + Intergenic
1022313157 7:29216562-29216584 GCCTCAAGGAGGCAAGAAGCAGG - Intronic
1023181249 7:37485911-37485933 CCTGGAAGAAGGCAAGTGGTTGG + Intergenic
1023994950 7:45154004-45154026 GCCTTAAGAAGGAAGGAGGCCGG + Intergenic
1024211172 7:47206833-47206855 TCCTGAATAAAGCAAGAGGCTGG + Intergenic
1025059997 7:55797943-55797965 GCCTGGAGAAGGGGAGTGGGAGG - Intronic
1025974869 7:66361764-66361786 CCATGAAGAAGGCAAGCAGCGGG - Intronic
1026581584 7:71623043-71623065 CCCAGGAGATGGCAAGTGGCAGG - Intronic
1026673885 7:72413003-72413025 ACCTGGAGTAGGCCAGTGGCTGG + Intronic
1029633921 7:101771246-101771268 ACCTAGAAAAGGCAAGTGGCCGG - Intergenic
1030311284 7:108071738-108071760 GCCTGAATTAGGGAAGTGGCAGG - Intronic
1031198075 7:118641990-118642012 GGCTTGAGAAGGCAAGTGGTGGG - Intergenic
1033228645 7:139580092-139580114 GGCTGCAGAAGGCAAGAAGCAGG - Intronic
1034624946 7:152485356-152485378 GCCTGACTAAGGCACATGGCAGG - Intergenic
1035106312 7:156444503-156444525 GCCTGAGGGAAGCCAGTGGCCGG - Intergenic
1035959439 8:4120626-4120648 GACTAGAGAAGGCCAGTGGCAGG - Intronic
1036452118 8:8877999-8878021 ACCTGAAGAAGGGAGGTGGGTGG - Intronic
1036753598 8:11457832-11457854 GCATGAGGAAAGCAAGTGACTGG - Intronic
1037822825 8:22143350-22143372 GCCTAAAGATGGACAGTGGCTGG - Intergenic
1038169164 8:25113153-25113175 GCCTTAAGAAGGACAGTGCCAGG - Intergenic
1039553091 8:38457344-38457366 GCCTGAACAAGGTAAGGTGCTGG - Exonic
1040868886 8:52079599-52079621 GCCTGCAGAGGGCACGTGTCAGG + Intergenic
1042201254 8:66281215-66281237 CCCTGGAGAAGGGAAGTGGCTGG - Intergenic
1042527064 8:69774358-69774380 GCCTGGAGAAGGTAAGAGTCAGG - Intronic
1046538222 8:115544231-115544253 GCCTGAAGAAGGCAAGTGGCTGG - Intronic
1048436565 8:134423971-134423993 GCATGAGGGAGGCAGGTGGCAGG - Intergenic
1048926422 8:139276517-139276539 CCCTGCAGAAGGCTGGTGGCTGG + Intergenic
1049069762 8:140347271-140347293 GCCTGAGGCAGGCAGGTGGCTGG - Intronic
1049580584 8:143408840-143408862 GCCTGGACAGGGCCAGTGGCTGG + Intergenic
1050434916 9:5599024-5599046 GCCTGAAAAAATCAAGTTGCAGG + Intergenic
1053692058 9:40591378-40591400 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1054272742 9:63046107-63046129 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
1054303315 9:63392344-63392366 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1054402094 9:64718854-64718876 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1054435700 9:65203169-65203191 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1054494693 9:65818518-65818540 GCCTGAAGATGGGAAGGGCCAGG - Intergenic
1055570808 9:77615191-77615213 GACTGAAGGAATCAAGTGGCTGG - Intronic
1056385430 9:86092775-86092797 GACTGATGAAGGCTGGTGGCAGG + Intronic
1057081316 9:92176590-92176612 GACGGAAAAAGGGAAGTGGCTGG - Intergenic
1057504817 9:95625521-95625543 GCCTCCAGTAGGCAACTGGCTGG - Intergenic
1057559777 9:96118098-96118120 TCCAGAAGAAGACAAGTGGATGG + Intergenic
1057737049 9:97672696-97672718 GGCTGAGGAAGACAAGGGGCTGG - Exonic
1057752021 9:97800487-97800509 GCCTGAAGTAGGGAGGTGGAAGG + Intergenic
1057824260 9:98360096-98360118 GTCTGAAGTAGGTAAGTGGGAGG + Intronic
1057950047 9:99362579-99362601 GCCAGAAGAAGGGATTTGGCTGG - Intergenic
1058350023 9:104010274-104010296 GCATTAAGAAGGAAGGTGGCAGG + Intergenic
1058911690 9:109525620-109525642 TCCTGAAGAGGGAGAGTGGCAGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059461456 9:114433220-114433242 GCCCGATGAAGGGAACTGGCAGG + Intronic
1059804882 9:117787880-117787902 ACCAGAAGAAGGGAAGTGGTGGG - Intergenic
1060007283 9:120011823-120011845 GCCTGAAGAAGGTCAGCTGCAGG + Intergenic
1061424007 9:130488052-130488074 GCCTTAAGAAGGAAGGGGGCCGG - Intronic
1062327285 9:136018297-136018319 GCCTGAGGAGGGCAGGAGGCAGG + Intronic
1062643172 9:137532584-137532606 GGCTGATGAAAGCAAGTGACAGG + Intronic
1203622722 Un_KI270749v1:137514-137536 GCCTGAAGATGGGAAGGGCCAGG + Intergenic
1187368445 X:18683866-18683888 GCCTAAAGAAGGAAGGTGCCTGG + Intronic
1187501744 X:19844650-19844672 GGCTTCAGAAGGCAAGTGGTAGG - Intronic
1188260331 X:28016104-28016126 GCATGAAGGAAGGAAGTGGCTGG + Intergenic
1189833380 X:44997458-44997480 GGTGGAAGAAGACAAGTGGCTGG - Intronic
1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG + Intergenic
1192264425 X:69529263-69529285 GTGAGAAGAAGGCCAGTGGCTGG + Intronic
1198086407 X:133286748-133286770 GCCTGAAGAAGGGAGGTGGATGG + Intergenic
1198107408 X:133474705-133474727 GCCAGCAGAAAGGAAGTGGCTGG - Intergenic
1201781048 Y:17723345-17723367 GCTTGGAGGTGGCAAGTGGCTGG - Intergenic
1201820505 Y:18182645-18182667 GCTTGGAGGTGGCAAGTGGCTGG + Intergenic