ID: 1046541590

View in Genome Browser
Species Human (GRCh38)
Location 8:115590495-115590517
Sequence ATATCAAGACTGTAAATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046541589_1046541590 6 Left 1046541589 8:115590466-115590488 CCAAAGAATCATAGTGATTCTGT 0: 1
1: 0
2: 3
3: 16
4: 252
Right 1046541590 8:115590495-115590517 ATATCAAGACTGTAAATACCAGG No data
1046541588_1046541590 20 Left 1046541588 8:115590452-115590474 CCAGTGATAAAATGCCAAAGAAT 0: 1
1: 0
2: 1
3: 22
4: 288
Right 1046541590 8:115590495-115590517 ATATCAAGACTGTAAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046541590 Original CRISPR ATATCAAGACTGTAAATACC AGG Intronic
No off target data available for this crispr