ID: 1046541595

View in Genome Browser
Species Human (GRCh38)
Location 8:115590514-115590536
Sequence CAGGGTGACAAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046541589_1046541595 25 Left 1046541589 8:115590466-115590488 CCAAAGAATCATAGTGATTCTGT 0: 1
1: 0
2: 3
3: 16
4: 252
Right 1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046541595 Original CRISPR CAGGGTGACAAGAAGGAGAA GGG Intronic
No off target data available for this crispr