ID: 1046542866

View in Genome Browser
Species Human (GRCh38)
Location 8:115609160-115609182
Sequence TGGTATTCCCTAACAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046542866_1046542869 18 Left 1046542866 8:115609160-115609182 CCACATTTTGTTAGGGAATACCA 0: 1
1: 0
2: 2
3: 14
4: 201
Right 1046542869 8:115609201-115609223 ACAGTAACATGTGCATAGGTAGG No data
1046542866_1046542868 14 Left 1046542866 8:115609160-115609182 CCACATTTTGTTAGGGAATACCA 0: 1
1: 0
2: 2
3: 14
4: 201
Right 1046542868 8:115609197-115609219 CTCAACAGTAACATGTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046542866 Original CRISPR TGGTATTCCCTAACAAAATG TGG (reversed) Intronic
901382766 1:8885774-8885796 TGGAATTCTCTGACTAAATGGGG + Intergenic
906471534 1:46134689-46134711 GTGCATTCCCAAACAAAATGAGG + Intronic
907707841 1:56847897-56847919 TGTTAATCCCTAAGACAATGGGG - Intergenic
908059928 1:60336613-60336635 TGGTAGACCCTAGCCAAATGTGG - Intergenic
908481447 1:64544223-64544245 TGATATTTGCTAAGAAAATGTGG - Intronic
909776113 1:79487514-79487536 TTTTATTCCCTAAAAGAATGGGG + Intergenic
909777431 1:79499301-79499323 TGGTATTTCTTAATAAAATCAGG - Intergenic
910166933 1:84337658-84337680 TGTTAATCCCTAAGACAATGGGG - Intronic
911178528 1:94841476-94841498 TGGTATTTCGTACCTAAATGTGG + Intronic
911239127 1:95446512-95446534 TGGTATTTGATAGCAAAATGGGG - Intergenic
911490726 1:98562954-98562976 TGTTAATCCCTAAGACAATGGGG + Intergenic
911904380 1:103548184-103548206 TGTTAATCCCCAAGAAAATGAGG - Intronic
913110495 1:115653382-115653404 TGGTATTTCATAACTAAATCTGG - Intronic
913278117 1:117158624-117158646 TGTTAATCCCTAAGACAATGGGG - Intronic
916959167 1:169872064-169872086 TGTTAATCCCCAAGAAAATGGGG + Intronic
917043623 1:170833320-170833342 TGTTATTCCCCAAGACAATGGGG + Intergenic
918672086 1:187230533-187230555 TGGTATTCACAGACAAAGTGGGG - Intergenic
921466302 1:215492372-215492394 TGTTAATCCCTAAGACAATGGGG + Intergenic
923093891 1:230759769-230759791 TGTTATTCCATGATAAAATGTGG - Intronic
923555631 1:234998456-234998478 TGGTGCTTCCTAACAAAATAAGG - Intergenic
924419678 1:243896532-243896554 TGGCATTCAATAACACAATGTGG - Intergenic
1063669031 10:8084865-8084887 ATGTAATCCTTAACAAAATGAGG - Intergenic
1065227258 10:23556813-23556835 TTGTATTCTCTACCAAAGTGCGG + Intergenic
1068494253 10:57765517-57765539 TGGGATTTTCTAACAAAATGTGG - Intergenic
1070701875 10:78609410-78609432 TAATATACCATAACAAAATGAGG - Intergenic
1072866546 10:99067770-99067792 TGTTATTCACTAAGACAATGGGG - Intronic
1075794067 10:125106500-125106522 AGTTCTTCACTAACAAAATGGGG + Intronic
1078496777 11:11825186-11825208 TGTTATTCCCGAAGACAATGGGG - Intergenic
1079654946 11:22975701-22975723 TGTTATTCCCTAAGACAATGGGG + Intergenic
1080204951 11:29717500-29717522 TGGTAATCCCCAAGACAATGGGG - Intergenic
1080725027 11:34889338-34889360 TGCTTTTATCTAACAAAATGTGG - Intronic
1081790875 11:45783579-45783601 TGTTATTCCCCATCAAAAAGTGG + Intergenic
1084495897 11:69502920-69502942 TTATAATACCTAACAAAATGTGG + Intergenic
1085866706 11:80303397-80303419 TGTTAATCCCTAAGACAATGGGG + Intergenic
1086056514 11:82653779-82653801 TGTTATTCCCCAAGACAATGGGG + Intergenic
1086176712 11:83900337-83900359 TGTTAATCCCTAAGAAAATGGGG + Intronic
1086192968 11:84102434-84102456 TTGTATTCCTTAACACATTGTGG - Intronic
1086644389 11:89201800-89201822 TTTTATTGCTTAACAAAATGGGG - Intronic
1087489555 11:98806979-98807001 TGGTATTGGATAAGAAAATGTGG - Intergenic
1087908337 11:103724841-103724863 TGGTAATCACTAATACAATGGGG - Intergenic
1087926230 11:103921940-103921962 TGGTAGTCACTAGCAACATGTGG - Intronic
1088098978 11:106132897-106132919 TGTTATTTCTGAACAAAATGTGG + Intergenic
1089405100 11:118191426-118191448 TGTTAATCCCTAAGACAATGGGG + Intergenic
1090281955 11:125463945-125463967 TGGAACTCCTTAACAAAATCAGG - Intronic
1094642823 12:32292709-32292731 AGGTATTACATAAGAAAATGTGG + Intronic
1095847146 12:46758688-46758710 TGTTAATCCCTAAGACAATGGGG + Intergenic
1098795938 12:74888174-74888196 TGTTAATCCCTAAGACAATGGGG - Intergenic
1098926948 12:76360986-76361008 TGTTAATCCCCAAGAAAATGGGG - Intronic
1100276523 12:93076681-93076703 TGGTGTTCCCTAACAAGAAATGG - Intergenic
1101663632 12:106788850-106788872 TGTTAATCCCCAAGAAAATGGGG - Intronic
1102610020 12:114103849-114103871 TGTTCCTCCCTAACAAAATTTGG + Intergenic
1106787746 13:33123894-33123916 TGGTACTTCCTATTAAAATGTGG + Intronic
1106791753 13:33162373-33162395 TGGTAATCCCCAAGACAATGGGG - Intronic
1107886578 13:44878810-44878832 TTATACTCCCTAACAAAATAGGG - Intergenic
1109871897 13:68343062-68343084 TGTTATTCCCTAAGACAATGGGG - Intergenic
1110786518 13:79534668-79534690 TCTTTTTCCCGAACAAAATGGGG - Intronic
1111481671 13:88836028-88836050 TGATATTCCCCACTAAAATGTGG + Intergenic
1112591947 13:100771740-100771762 TGGTATCCCATAACCACATGTGG + Intergenic
1114812475 14:25917074-25917096 TGGTAATCCCCAAGACAATGGGG + Intergenic
1116131315 14:40858168-40858190 AGGTATTACTTAAAAAAATGGGG + Intergenic
1116426156 14:44794480-44794502 TGGTATTCCATAAAAGAATTGGG - Intergenic
1116456681 14:45127650-45127672 TGGTAGTTACTAACAATATGTGG - Intronic
1116789679 14:49327277-49327299 TGTTAATCCCTAAGACAATGGGG + Intergenic
1117300687 14:54423433-54423455 TGATATTCCCCAAAACAATGAGG + Intergenic
1118289606 14:64507180-64507202 TTGTCTTCCCAAAAAAAATGAGG + Intronic
1118539521 14:66806366-66806388 TGTTAATCCCCAAGAAAATGGGG - Intronic
1121133320 14:91470268-91470290 TGGTTTTCTCTAACAAACTCGGG + Intronic
1126514951 15:49524126-49524148 TGTTAATCCCCAACAGAATGGGG + Intronic
1130609904 15:85351591-85351613 TGGTTTTCCCTTTCAAACTGTGG + Intergenic
1133669192 16:8000964-8000986 TGGTATTCCCTAACCACATGTGG - Intergenic
1133898771 16:9953616-9953638 TGGCATCCCCTAACAAAAGAAGG + Intronic
1135392947 16:22109333-22109355 TGCTTTTCCCTTATAAAATGAGG + Intronic
1135508951 16:23065033-23065055 TGGTAATCCCTTAGATAATGTGG - Exonic
1135759421 16:25125244-25125266 ATGTATTCTCTAACAAAATTGGG + Intronic
1137924517 16:52527543-52527565 AGGTATTCTCTAACAGAAAGAGG + Intronic
1139974269 16:70796472-70796494 TGGTTTTCCCTACCAGAAAGGGG - Intronic
1143791444 17:9299235-9299257 TGGAATTCACAAAAAAAATGTGG - Intronic
1146000478 17:29127674-29127696 TGGCTTTCCCTAACCCAATGCGG - Intronic
1147115237 17:38294345-38294367 TGGTATTCCCAACCAAAGTGAGG - Intergenic
1147398782 17:40166101-40166123 TGATATCCACTAACCAAATGTGG - Intronic
1148904283 17:50901842-50901864 TGGTAGCCACTAACAACATGTGG + Intergenic
1152064107 17:78100679-78100701 TGTTAATCCCTAAGACAATGGGG - Intronic
1153371471 18:4321757-4321779 AGGTATTATGTAACAAAATGAGG + Intronic
1155845380 18:30698887-30698909 TATTATTTCCTAACAAAATTGGG - Intergenic
1155988172 18:32252704-32252726 TGTTATTCCCAAAGACAATGGGG - Intronic
1158422303 18:57306045-57306067 TGGTAGCCTCTAACCAAATGTGG - Intergenic
1160096397 18:75877607-75877629 TGTTATTCCCAAAGAAAATGGGG + Intergenic
1161788490 19:6343613-6343635 TGGCCTCCACTAACAAAATGTGG + Intergenic
1163636784 19:18440749-18440771 TGTTATTCCCCAGCAAAGTGTGG + Intergenic
925696945 2:6590553-6590575 TGGCTTTCCCTAAAAAAATGGGG + Intergenic
926502509 2:13673520-13673542 TGTTATTCCCCAAGACAATGGGG - Intergenic
926760504 2:16274469-16274491 TGGTAGTCACTAACTACATGTGG + Intergenic
926952074 2:18253887-18253909 TGTTATTCCCTAATACAATGGGG + Intronic
928111514 2:28513694-28513716 TGGGAGTGCCTAACAGAATGCGG + Intronic
928804411 2:35132851-35132873 TGTTATTCCCCAAGATAATGGGG - Intergenic
929518667 2:42627384-42627406 TGGTTTTCCCTAATATAATTAGG - Intronic
930546718 2:52776883-52776905 TGGTATTCTCTTACAAGTTGAGG - Intergenic
932401604 2:71484580-71484602 TAGTATTCCCTAGCACAATAGGG - Intronic
933078479 2:77958508-77958530 TAGTATTTCATAACAAAATAGGG + Intergenic
935205480 2:100893178-100893200 TTTTATTCCTTAACATAATGAGG + Intronic
935260054 2:101346657-101346679 TATTAGTCCCTAATAAAATGAGG - Exonic
937427590 2:121813205-121813227 TGTTAATCCCTAAGACAATGGGG + Intergenic
937805872 2:126145009-126145031 TGGTATTGACTAAGAAAGTGAGG + Intergenic
939280538 2:140058392-140058414 TGGTTTTCACTCACATAATGAGG - Intergenic
941589347 2:167399841-167399863 GGATATACCCTAGCAAAATGAGG - Intergenic
943380154 2:187134661-187134683 TGGTGGTCCCTGACAAGATGAGG - Intergenic
946609611 2:221443183-221443205 TAGTTTTCTCTAATAAAATGGGG - Intronic
947367378 2:229410490-229410512 TGGTTTTCTCTGACAAAATAGGG - Intronic
947888508 2:233595390-233595412 TGTTAATCCCTAATACAATGGGG + Intergenic
947888727 2:233596783-233596805 TGTTAATCCCTAATACAATGGGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1177442973 21:21151995-21152017 TTGTATTGCTTAATAAAATGTGG + Intronic
1178008180 21:28247609-28247631 AGGTATTCCCGAAGACAATGTGG - Intergenic
1178823542 21:35996406-35996428 TGGTAGTCACTAACCACATGTGG - Intronic
1178902538 21:36608955-36608977 TGTTCTTCCCTAACAAAAGGTGG - Intergenic
1179190782 21:39120049-39120071 AGGTCTTCCAGAACAAAATGTGG + Intergenic
1180610173 22:17091138-17091160 TGATATTCTCCAGCAAAATGAGG - Intronic
1182700963 22:32238004-32238026 TGCCAAACCCTAACAAAATGGGG + Intronic
1182782939 22:32882158-32882180 TGGTCTTCCCTGACAAGCTGCGG + Intronic
949363200 3:3253421-3253443 TGTTAATCCCTAAGACAATGGGG - Intergenic
949421872 3:3874324-3874346 TGGTATGCACTAGCAACATGTGG - Intronic
949665264 3:6331700-6331722 TGTTAATCCCTAAGAAAATGGGG + Intergenic
950815356 3:15695763-15695785 TGGAATTCCCTAAATATATGGGG + Intronic
950871045 3:16229283-16229305 TGGTAGCCACTAACAAAATGTGG + Exonic
953138544 3:40205392-40205414 TGGTTTAGCCTAAGAAAATGAGG + Intronic
953242848 3:41165248-41165270 GGTTATTCCCTCATAAAATGGGG - Intergenic
954532555 3:51333455-51333477 TGGGATTCCCCACTAAAATGTGG + Intronic
956336869 3:68174815-68174837 TGTTATTGCCTAAGACAATGGGG + Intronic
957502025 3:81069521-81069543 TGGTATTCCAAAACAATTTGGGG - Intergenic
957608669 3:82438375-82438397 TGGTCTTGCCTAATAAAATTAGG - Intergenic
960262110 3:115579905-115579927 TGGTTTTCCTAAATAAAATGTGG - Intergenic
962193025 3:133331179-133331201 TGGTAGGCCTCAACAAAATGAGG + Intronic
962291310 3:134138683-134138705 TGAAATTGCTTAACAAAATGAGG + Intronic
963024277 3:140902865-140902887 TGGTAGTCACTAACCACATGTGG - Intergenic
965674252 3:171178275-171178297 TGGTTTTACCTAATAAGATGAGG + Intronic
966716390 3:183017177-183017199 TGGTATTAACTTACAAAATAAGG + Intronic
967249296 3:187520448-187520470 TGGTATCACCTAGCCAAATGGGG + Intergenic
967412561 3:189181236-189181258 TGTTAATCCCCAAGAAAATGGGG - Intronic
968537541 4:1144055-1144077 TGGTATTCCCTAACAAAAAAAGG - Intergenic
970763219 4:19516769-19516791 TGTTATTCCCCAAGACAATGGGG + Intergenic
970817664 4:20177335-20177357 TGGTGTTCCAAAACAAAAAGGGG - Intergenic
971519973 4:27537192-27537214 TGCTATTCCATTACAATATGTGG - Intergenic
971831904 4:31705197-31705219 TGTTAATCCCTAAGACAATGGGG - Intergenic
971948630 4:33315081-33315103 TGGTAATCCCCAAGATAATGGGG + Intergenic
973015789 4:45135230-45135252 TGGTAATCCCCAAAACAATGAGG - Intergenic
976051062 4:81012145-81012167 TGTTAATCCCTAAGACAATGGGG + Intergenic
976503190 4:85815227-85815249 TGTTATTTCCAAAAAAAATGGGG - Intronic
979125672 4:116969081-116969103 TGTTAATCACTAAGAAAATGGGG - Intergenic
979464699 4:121022588-121022610 TGTTAATCCCCAAGAAAATGAGG - Intergenic
979543187 4:121910081-121910103 TGGCATTTCCTTCCAAAATGTGG + Intronic
980715940 4:136630085-136630107 TGGAATTTCCTAAAAAAATATGG + Intergenic
981776274 4:148371246-148371268 TAGTATTTCCTAGCACAATGGGG - Intronic
983378882 4:166966372-166966394 TGTTATTCTGTGACAAAATGTGG + Intronic
983460759 4:168023207-168023229 TGTTAATCCCTAAGACAATGGGG - Intergenic
985974301 5:3403508-3403530 TTGTATTACCTTATAAAATGGGG + Intergenic
986304675 5:6506470-6506492 TGTTTTTCCCTACTAAAATGGGG - Intergenic
986483160 5:8209900-8209922 TGCTATTTGCTAACAAAATAAGG - Intergenic
986756811 5:10844245-10844267 TGTTAATCCCTAAGACAATGGGG - Intergenic
988024867 5:25672408-25672430 TGGAATTCTCAAACAAAATGTGG - Intergenic
989731397 5:44654237-44654259 TGTTATTCCCCAACACAATGGGG - Intergenic
991219059 5:64191051-64191073 TGGTATTCATTAACAAAAAAAGG - Intronic
991476470 5:67025936-67025958 TGCTTTTCCCTAATTAAATGTGG + Intronic
993215930 5:85022161-85022183 TGTTATTCCCCAAGACAATGGGG - Intergenic
993753694 5:91701307-91701329 TGTTATTCCCCAAGACAATGGGG - Intergenic
994338724 5:98600672-98600694 TGTTAATCCCCAAGAAAATGGGG + Intergenic
994524151 5:100882558-100882580 TGTTAATCCCTAAGACAATGGGG + Intronic
994656014 5:102593673-102593695 TGTTAATCCCCAACACAATGGGG - Intergenic
996256309 5:121408271-121408293 AGTTAATCCCTAAGAAAATGTGG - Intergenic
996600228 5:125253910-125253932 TGTTAATCCCTAAGACAATGGGG - Intergenic
996910278 5:128649324-128649346 TTGTATACACTAACATAATGGGG + Intronic
1002984503 6:2175900-2175922 TAGTATTACCTTATAAAATGGGG - Intronic
1003850514 6:10217809-10217831 TGGTTGTCCATAACAAAAAGTGG - Intergenic
1004252725 6:14035088-14035110 TGCTATTCCCTAGTGAAATGAGG - Intergenic
1005673053 6:28126438-28126460 TGGTAGTCACTAGCAAAATGTGG - Intronic
1005831869 6:29677422-29677444 TGGCATTCCCTGACCAAATAAGG - Intronic
1012300547 6:97582294-97582316 TAGTATTTGCTAGCAAAATGGGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013558825 6:111283953-111283975 TGTTAATCCCCAACACAATGGGG - Intergenic
1013863087 6:114660262-114660284 TGTTATTCCCTAAAACCATGGGG + Intergenic
1014407410 6:121068840-121068862 TGTTATTCACCAAGAAAATGAGG + Intergenic
1015137083 6:129884904-129884926 TATTCTTCCCTAACAAAGTGTGG - Intergenic
1015454310 6:133408205-133408227 AGGTATTCCCCAACAAAAGATGG - Intronic
1027369517 7:77493899-77493921 TGTTATTCCCCAAGACAATGGGG + Intergenic
1029911604 7:104157202-104157224 TTGTGTTCCAGAACAAAATGTGG - Intronic
1031275279 7:119713008-119713030 TGTTAATCCCCAAGAAAATGGGG - Intergenic
1033509006 7:142035940-142035962 TAGTACTCACTGACAAAATGAGG + Intronic
1037213886 8:16425661-16425683 TGTTAATCCCTAAGACAATGGGG + Intronic
1039034389 8:33343998-33344020 TGGGAATTCCTAACACAATGGGG - Intergenic
1042169726 8:65979889-65979911 TGTTAATCCCTAAGACAATGGGG + Intergenic
1043920518 8:85978129-85978151 GGGTATTCACTATCAAAATAAGG + Intergenic
1044349395 8:91145979-91146001 TTGTATTCCCTAACTTAATTGGG - Intronic
1046542866 8:115609160-115609182 TGGTATTCCCTAACAAAATGTGG - Intronic
1046928986 8:119824520-119824542 TGTTAATCCCCAAGAAAATGGGG + Intronic
1048348619 8:133597661-133597683 TGGTATTACCAACCACAATGAGG + Intergenic
1048668393 8:136689822-136689844 TGGTAATCCCCAAAACAATGGGG - Intergenic
1051450731 9:17194185-17194207 TGTTAATCCCTAAGACAATGGGG - Intronic
1051608891 9:18942622-18942644 TGGTACTCCCTGAAACAATGGGG - Intronic
1052538401 9:29776818-29776840 AGGAATTCCCTATCAAAATCAGG - Intergenic
1053359291 9:37472628-37472650 TGGTAATCACTAACAGACTGTGG - Intergenic
1055083499 9:72290694-72290716 TGTTAATCCCTAAGACAATGGGG - Intergenic
1056012401 9:82346123-82346145 TGTTAATCCCTAAGACAATGGGG + Intergenic
1057632342 9:96730154-96730176 TGGTAATGCATAACAAATTGTGG - Intergenic
1058269471 9:102952091-102952113 TGTTATTCCCTTTGAAAATGAGG - Intergenic
1058401492 9:104624999-104625021 TGTTAATCCCTAAGATAATGGGG + Intergenic
1186797705 X:13062608-13062630 TGTTAATCCCCAAGAAAATGGGG - Intergenic
1188796627 X:34474564-34474586 TGTTATTCCCAAACAATATTGGG + Intergenic
1194336856 X:92658806-92658828 TGGTATTCAGTAGCAAAATAGGG + Intergenic
1194397598 X:93404391-93404413 TGTTAATCCCTAAGACAATGGGG - Intergenic
1194936359 X:99954161-99954183 TAGTTTTCACTAATAAAATGTGG - Intergenic
1195411686 X:104573361-104573383 TGGTATTCACTGACCACATGTGG - Intronic
1196391277 X:115210154-115210176 TGTTAATCCCCAAGAAAATGGGG + Intronic
1197862868 X:130988609-130988631 TGGAATTCCCTCACAACAGGTGG - Intergenic
1198424671 X:136504804-136504826 TGGTACTCCCCACCAAAATCAGG - Intronic
1198626980 X:138587207-138587229 TGGTATTCCTGAAAAAGATGTGG - Intergenic
1198852093 X:140975491-140975513 TGGAATTCCCTATCAAAAGAAGG - Intergenic
1198888238 X:141362488-141362510 TGGTAATCCCCAAAACAATGGGG - Intergenic
1200645290 Y:5775546-5775568 TGGTATTCAGTAGCAAAATAGGG + Intergenic
1202015548 Y:20402394-20402416 TGTTAATCCCCAACACAATGAGG - Intergenic