ID: 1046544093

View in Genome Browser
Species Human (GRCh38)
Location 8:115625438-115625460
Sequence CTATAGTCTTTCAGTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046544093_1046544094 -7 Left 1046544093 8:115625438-115625460 CCAATTGCACTGAAAGACTATAG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1046544094 8:115625454-115625476 ACTATAGAACAGCAAACCACCGG No data
1046544093_1046544095 1 Left 1046544093 8:115625438-115625460 CCAATTGCACTGAAAGACTATAG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1046544095 8:115625462-115625484 ACAGCAAACCACCGGCGCCAAGG No data
1046544093_1046544097 5 Left 1046544093 8:115625438-115625460 CCAATTGCACTGAAAGACTATAG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1046544097 8:115625466-115625488 CAAACCACCGGCGCCAAGGGTGG No data
1046544093_1046544096 2 Left 1046544093 8:115625438-115625460 CCAATTGCACTGAAAGACTATAG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1046544096 8:115625463-115625485 CAGCAAACCACCGGCGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046544093 Original CRISPR CTATAGTCTTTCAGTGCAAT TGG (reversed) Intronic
900891628 1:5453951-5453973 CTAGGGGCTTTCAGTGCAGTGGG + Intergenic
908652625 1:66352472-66352494 CTATAGTCTTCCATTGCCACAGG - Intronic
910239822 1:85074325-85074347 CCATAGTCTTTCTTTGCCATTGG + Intronic
916430802 1:164726278-164726300 CTATGGTCTTTCCCTGCCATGGG + Intronic
918814855 1:189169436-189169458 CTATAAAATTTCAGTGCATTGGG + Intergenic
1064679933 10:17800528-17800550 CAATTGTCATTCAGTGAAATGGG - Exonic
1075805724 10:125187508-125187530 CTAAAGTCTTTGAGTGGAAGTGG + Intergenic
1080120589 11:28672970-28672992 CTATAGTCTTACATTGTATTAGG - Intergenic
1088061304 11:105654236-105654258 CTACAGGATTTCAGTGAAATAGG + Intronic
1093151938 12:15632020-15632042 ATTTAGACTTCCAGTGCAATTGG - Intronic
1093504915 12:19853901-19853923 ATATAATCTTTCAGTGCAATTGG - Intergenic
1095072612 12:37873290-37873312 CTTTAGTCTTACAGTGGAAAAGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1103013526 12:117476386-117476408 CTCAAGTCTTTCAGTGCTTTTGG - Intronic
1105730601 13:23211648-23211670 CTTTTGTTTTTCAGTGCAATAGG - Intronic
1107826475 13:44332973-44332995 CTATGGTCTTACAGTGGAATTGG - Intergenic
1108805203 13:54146199-54146221 CTGTATTCTTTTTGTGCAATTGG + Intergenic
1110513851 13:76385353-76385375 CTATAGTCATGCAATGCAAGGGG - Intergenic
1110651599 13:77948587-77948609 CTTTAGTTTCTCAGTGAAATGGG + Intergenic
1112039863 13:95535987-95536009 CTATGGTGTTTCAGTGGAAAGGG + Intronic
1113730770 13:112639698-112639720 CTCTTGTCTTCCAGTGCCATGGG - Intergenic
1115127884 14:30018114-30018136 TTATAGTCTTTAACTGCAAGGGG + Intronic
1116609554 14:47050116-47050138 ACACAGTCTTTCAGTGGAATGGG - Intronic
1118357819 14:65029837-65029859 CTACAGTCCATCACTGCAATTGG - Intronic
1118417843 14:65562770-65562792 CTAAAGGCTTTCTGTACAATTGG - Intronic
1121018445 14:90563045-90563067 CTATAGCCTTTCAGTACCAGAGG + Intronic
1124137903 15:27051141-27051163 CTATAGACTTTCATTCCAAAGGG + Intronic
1124465301 15:29933735-29933757 CTTTAGTCTTTCAGTATACTGGG - Intronic
1128525045 15:68406645-68406667 CTATAGTCTCTAAGTGCCACGGG + Intronic
1128961733 15:72013500-72013522 CTATGTTCTTTCAGTGGAAGGGG - Intronic
1129615643 15:77097245-77097267 CTTTTGTCTGTCAATGCAATTGG + Intergenic
1130748671 15:86685404-86685426 CAATATTGTTTCAGTACAATAGG + Intronic
1133618393 16:7501825-7501847 CTAGAGATTTACAGTGCAATAGG - Intronic
1144412930 17:15019031-15019053 CTATGGTCTCCCATTGCAATTGG - Intergenic
1155867116 18:30979378-30979400 TTTTTGTCTTTCAGTGCACTAGG + Intergenic
1156932191 18:42659152-42659174 CTTTAGTCTTTCAGTAAAGTAGG + Intergenic
1165263539 19:34641097-34641119 CAATAGTATTTGAGTCCAATTGG - Intronic
1165604044 19:37083934-37083956 CTATAATCTTTTATTTCAATTGG - Intronic
928875015 2:36027850-36027872 CTATAGGGTATCAGTGGAATTGG + Intergenic
929422492 2:41807303-41807325 CTATAGACTATCAGTGCCAGTGG + Intergenic
935158078 2:100501708-100501730 ATATAGTCTTTCTGTCCACTGGG - Intergenic
935412991 2:102785385-102785407 CCATAGTCTTTCCTTGCACTTGG + Intronic
936258784 2:110939377-110939399 GTATATTCTTTCTGTGCAGTGGG + Intronic
936723943 2:115289592-115289614 CTATAGTCTGGTAGTACAATTGG - Intronic
939690148 2:145249452-145249474 CTACAGTCTTTAACTGGAATGGG + Intergenic
940831020 2:158466061-158466083 CTATAGTATATCAGTTCCATGGG + Intronic
941196528 2:162459594-162459616 CTTAGGTCTTTCAGTGTAATGGG + Intronic
943235529 2:185313759-185313781 CTAAAGTCTTTCTTTGCCATTGG + Intergenic
944009774 2:194960374-194960396 GTTTAGTGTTTCACTGCAATAGG + Intergenic
945442103 2:209892482-209892504 CTGTAATTTTTCAGTGCTATAGG + Intronic
946842292 2:223830799-223830821 CTTTAGTCTTTCAGTGCGATGGG - Intronic
1175726487 20:61322142-61322164 ATTTATTCATTCAGTGCAATGGG + Intronic
1177331569 21:19671825-19671847 TAATAGTTTTTCAGTGGAATTGG - Intergenic
1182107680 22:27700914-27700936 CTCTCAACTTTCAGTGCAATGGG - Intergenic
952057524 3:29466189-29466211 CTATAGTCTTTAATTGGCATTGG - Intronic
953294908 3:41705064-41705086 CGATAGTCTTTCAATAAAATAGG + Exonic
960429019 3:117546044-117546066 CTATATTCATTCAGTGAAAGGGG - Intergenic
962627925 3:137245750-137245772 CTATTGTCTTTCATTGCGTTGGG - Intergenic
965925427 3:173973135-173973157 CTAAAGACTTCCAGTGCATTGGG - Intronic
970183543 4:13424623-13424645 CTGTAGTTTCTCAGTGAAATAGG - Intronic
977259354 4:94780381-94780403 ATATAGTCTATCTATGCAATGGG - Intronic
980637255 4:135523555-135523577 CCAGAGTCTTTCAGGGCAGTAGG + Intergenic
980796403 4:137689636-137689658 CTATAGGCTTTTATTTCAATTGG - Intergenic
981062271 4:140437491-140437513 CTCAAGACTTTCAGTTCAATGGG + Intergenic
981759549 4:148178705-148178727 CTATATTCTCTCAGCCCAATCGG + Intronic
984058595 4:174962960-174962982 CTAAAGTTTTTCAGTGGATTTGG - Intronic
988815718 5:34832674-34832696 CAATAGCATTTCAGTGTAATAGG + Intergenic
991118574 5:62983829-62983851 CTCTAATCTTTCAGTGGTATAGG - Intergenic
991403502 5:66278478-66278500 CTATAGTCTTTCAGGGGCAGTGG + Intergenic
998679046 5:144444256-144444278 CCATAGTCTTTCATTTGAATTGG - Intronic
1000880226 5:166689040-166689062 CTATAGTCCTGCTGTGCATTAGG + Intergenic
1003286787 6:4741292-4741314 CCATAGTCTTAAAGTTCAATTGG + Intronic
1008780779 6:55101948-55101970 ATATAGCTTTTTAGTGCAATAGG - Intergenic
1016619761 6:146094707-146094729 TTATAATCTTGCAGTGGAATAGG + Intronic
1021571904 7:22074600-22074622 TTATAGTATCTCAGTGCCATAGG - Intergenic
1022028520 7:26470366-26470388 CTCTGGTCTTTCAGTGCTCTTGG + Intergenic
1028091447 7:86708010-86708032 ATATAGTCTCTCAGTGACATTGG - Intronic
1032308299 7:130757198-130757220 TTAAAGTCTTTCTGTGTAATTGG + Intergenic
1035622529 8:1044664-1044686 TTCTAGTCTTTTAGTGCAATGGG - Intergenic
1038949752 8:32401525-32401547 CTATAGTCATTCGATGAAATAGG + Intronic
1042909311 8:73809044-73809066 CTATAGTCTTTAAGCGTAACAGG + Intronic
1043242591 8:77954294-77954316 GTATAGTCATTCAGTGTATTTGG + Intergenic
1043424996 8:80139679-80139701 CTATAGTGTTCAAGTGCATTGGG - Intronic
1043449008 8:80348327-80348349 CAATAGACATTCTGTGCAATTGG - Intergenic
1043581401 8:81720298-81720320 CCAAGGTCTCTCAGTGCAATGGG + Intronic
1044485350 8:92746325-92746347 TTATAGACTTTCTTTGCAATTGG - Intergenic
1046544093 8:115625438-115625460 CTATAGTCTTTCAGTGCAATTGG - Intronic
1048237983 8:132711194-132711216 CTATAGTCTTTCAGACAAAAAGG - Intronic
1048705206 8:137146181-137146203 CTGTACTCTTTCTTTGCAATTGG - Intergenic
1055274035 9:74593892-74593914 ATATAGTACATCAGTGCAATGGG + Intronic
1058025898 9:100142108-100142130 CTAGAGTCATTCACTGCAAGGGG - Intronic
1058567357 9:106300613-106300635 CTGTAGTCTGTCAGTGTAATTGG + Intergenic
1060145048 9:121245300-121245322 CTATAGTCCTCCACTTCAATTGG + Intronic
1186370353 X:8940391-8940413 CTGTGGTCTTTCAGAGCAAGTGG - Intergenic
1196244343 X:113381995-113382017 CTATAGCCTTGCAGTATAATTGG - Intergenic