ID: 1046544938

View in Genome Browser
Species Human (GRCh38)
Location 8:115638070-115638092
Sequence ATTTACATGGGGTGTATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046544938_1046544946 4 Left 1046544938 8:115638070-115638092 CCCACTATACACCCCATGTAAAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1046544946 8:115638097-115638119 AGTTAAAATAAGGGCCAGGAAGG No data
1046544938_1046544944 -5 Left 1046544938 8:115638070-115638092 CCCACTATACACCCCATGTAAAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1046544944 8:115638088-115638110 TAAATCAGTAGTTAAAATAAGGG No data
1046544938_1046544945 0 Left 1046544938 8:115638070-115638092 CCCACTATACACCCCATGTAAAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1046544945 8:115638093-115638115 CAGTAGTTAAAATAAGGGCCAGG No data
1046544938_1046544943 -6 Left 1046544938 8:115638070-115638092 CCCACTATACACCCCATGTAAAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1046544943 8:115638087-115638109 GTAAATCAGTAGTTAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046544938 Original CRISPR ATTTACATGGGGTGTATAGT GGG (reversed) Intronic
902966516 1:20008519-20008541 ATTTACATGTGGTTAAAAGTGGG - Intergenic
909072109 1:71007211-71007233 ATTTACATGGTGTGCCTAGGAGG - Intronic
912146535 1:106800652-106800674 ATTTAAATGGGGTCTAGAGGAGG - Intergenic
912458217 1:109813604-109813626 ATTTTCACAGGCTGTATAGTTGG + Intergenic
918979975 1:191544456-191544478 ATTTACATGGGAGGTCTTGTAGG + Intergenic
920959930 1:210655147-210655169 CTTTACATGGGGTTAATTGTTGG - Intronic
921184056 1:212655200-212655222 ATTTAAATGGGGTTTGGAGTTGG + Intergenic
924485864 1:244483268-244483290 ATTTACATGTGCATTATAGTTGG + Intronic
1063221462 10:3972420-3972442 ATTAAAATGGTGTGTATGGTAGG + Intergenic
1063290179 10:4736916-4736938 ATTTAGATGCTGTGTATAGAGGG - Intergenic
1063581428 10:7311174-7311196 AATTACATGGATTGTATAATGGG - Intronic
1065666398 10:28067041-28067063 ATTTCCATTGGGTGTGCAGTAGG + Intronic
1068938932 10:62662100-62662122 ATTTACATAGGGTGTACACCTGG - Intronic
1073627735 10:105117121-105117143 ATTTTCATAGGCTGTCTAGTGGG + Intronic
1074670869 10:115789225-115789247 ATTTACATGGGATAAATACTTGG - Intronic
1074758459 10:116645928-116645950 ATGTACATGGTATGTATGGTTGG + Intergenic
1076482070 10:130791469-130791491 ATGTACATGTGGTGTGTGGTGGG - Intergenic
1077438552 11:2556966-2556988 ATTTACATTTGGTGTGAAGTTGG - Intronic
1077542688 11:3154796-3154818 ATTTACATTAGGTATATAGGGGG - Intronic
1077727490 11:4689540-4689562 TTTAAGATGGGCTGTATAGTTGG - Intronic
1089416747 11:118298459-118298481 AATTAAATAGGGTGTATAATGGG - Intergenic
1098741034 12:74173415-74173437 CTTTTCATGGGGTGTATTGGTGG - Intergenic
1099744480 12:86685206-86685228 TTTTACATGAGGTGTAAAGAAGG + Intronic
1101243710 12:102864195-102864217 TTTTACATAGGGTGTAGAGAGGG + Intronic
1104618735 12:130293252-130293274 ATTTACTTGGGGAATATAGAAGG - Intergenic
1108525661 13:51284017-51284039 ATTTCCATGTGGTCTACAGTGGG - Intronic
1111992085 13:95126540-95126562 CTTTACATAGGGTGGGTAGTGGG - Intronic
1113064617 13:106360493-106360515 AGTTACTTGGGGTGTTTCGTAGG - Intergenic
1118856096 14:69624256-69624278 ATGTAGCTGAGGTGTATAGTAGG + Intronic
1125409288 15:39388669-39388691 ATTTACCTGGGGTTTGTACTTGG - Intergenic
1138849444 16:60608841-60608863 ATTTTCATGGTGTATATATTTGG + Intergenic
1144308566 17:13991743-13991765 ATTTGCATGGGGTTTTTGGTGGG + Intergenic
1155310882 18:24522123-24522145 CTTTTCCTGGGGTGTATGGTGGG + Intergenic
1156426795 18:37022370-37022392 ATTTAAACTGGGAGTATAGTGGG - Intronic
1158678675 18:59546976-59546998 AATTACATGGGGTTTAAAGCAGG + Intronic
1162901245 19:13796374-13796396 ATTTACTTGGGGTGTACGGTAGG - Intronic
1166934709 19:46324405-46324427 ATTTTCTTGGGGTGGAGAGTGGG - Intronic
1167816812 19:51889977-51889999 ATTTAAAGTGGGTGTTTAGTGGG - Exonic
927078915 2:19608683-19608705 ATTTTCATGGGGTGAATTGGAGG - Intergenic
927293377 2:21426035-21426057 GTTGACATGGGGAGTATAGATGG - Intergenic
928801741 2:35102365-35102387 ATTTAAATGTGATGTTTAGTGGG + Intergenic
930442172 2:51422753-51422775 TTTTACATGGGGTATATTCTAGG - Intergenic
932692477 2:73925132-73925154 ATTTACATAGGGTGTACACCAGG - Intergenic
937623999 2:124023853-124023875 CTTTACTTGGGGTGCATGGTAGG - Intergenic
938126401 2:128676046-128676068 ATTTACATGCAGGGGATAGTTGG - Intergenic
938552789 2:132396087-132396109 ATATAGATGGGGCATATAGTGGG - Intergenic
939235823 2:139491110-139491132 ATATAGACTGGGTGTATAGTAGG - Intergenic
939847208 2:147261762-147261784 AGTTTCATGGGATGTATATTTGG - Intergenic
942570183 2:177305998-177306020 ATTTGGATGGGGGGTAAAGTCGG + Intronic
943059983 2:183032447-183032469 ATGTACCCTGGGTGTATAGTAGG - Intronic
945322562 2:208442127-208442149 ATTTCCTGGGGGTGGATAGTGGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945772568 2:214062505-214062527 ATTGAAATGGGTTGTGTAGTGGG - Intronic
1170025055 20:11880011-11880033 ATTTACAATGGCTGTATAATGGG + Intergenic
1171194029 20:23182967-23182989 ACTTACAAGGGGTGTGAAGTTGG - Intergenic
1172193881 20:33078840-33078862 ATGTAAATGGTGGGTATAGTTGG + Intergenic
1173399627 20:42712884-42712906 ATTTACTTGGGTTCTATAGGTGG - Intronic
1174675775 20:52353092-52353114 ATTTACAGTGGGTGTCTTGTAGG + Intergenic
1175561730 20:59936058-59936080 ATATACCTGAGGTGTGTAGTAGG - Intronic
1180798721 22:18621302-18621324 ATGGACATGGGGAGTGTAGTGGG + Intergenic
1181222993 22:21373960-21373982 ATGGACATGGGGAGTGTAGTGGG - Intergenic
1181255746 22:21561659-21561681 ATGGACATGGGGAGTGTAGTGGG + Intronic
1181618248 22:24070041-24070063 ATTTAAATGGGTTGTATTCTAGG + Intronic
1183783341 22:40013277-40013299 CTTTACATGTGGTGTGAAGTAGG + Intronic
951105598 3:18738345-18738367 TTTTTCATGGAGTTTATAGTTGG - Intergenic
953423690 3:42774537-42774559 TTTTAAATGGTGTGTGTAGTGGG + Intronic
958086259 3:88811609-88811631 GTTTTCATGGGATTTATAGTAGG + Intergenic
958702152 3:97606167-97606189 GCTCTCATGGGGTGTATAGTAGG - Intronic
960311944 3:116127356-116127378 ATTAAGATGGGATGTATAGATGG - Intronic
963626152 3:147676588-147676610 ATTTAGATTAGGTTTATAGTGGG - Intergenic
963834302 3:150040894-150040916 ATTTACATGGTCTGTATTCTTGG + Intronic
964553041 3:157906254-157906276 ATTTCCATGTGCTCTATAGTGGG - Intergenic
969336599 4:6513992-6514014 ATACAGATGGGGTGTATAATTGG + Intronic
970788771 4:19831833-19831855 ATTTAAATAGGGTGTGTATTAGG + Intergenic
974275121 4:59709783-59709805 ATTTACATGGTGAGTAAATTTGG - Intergenic
976577514 4:86691359-86691381 TATGACATGGGGTGTATTGTGGG + Intronic
977324303 4:95555171-95555193 AGTTTCATGGAGTTTATAGTTGG + Intergenic
979915358 4:126425949-126425971 AATTATATGAGGTATATAGTAGG + Intergenic
981974543 4:150709800-150709822 ATTTACATTGGGTGATTGGTGGG + Intronic
989280585 5:39638253-39638275 ATTTACATAGCGTTTATACTAGG - Intergenic
989701513 5:44271048-44271070 CTTTCCATAGGGTGTAGAGTCGG + Intergenic
993047218 5:82881171-82881193 ATGTACATGGGCAGTACAGTGGG + Intergenic
993388340 5:87287043-87287065 ATATACATGGGGTATATATATGG - Intronic
995161045 5:108982304-108982326 ATTTAGATGGAGAATATAGTAGG + Intronic
999541924 5:152583999-152584021 ATTTACATGTAATGGATAGTAGG + Intergenic
1001240018 5:170061568-170061590 CATTACAGGGGTTGTATAGTTGG - Intronic
1003302665 6:4898415-4898437 ATTGACATGTCCTGTATAGTGGG + Intronic
1006988127 6:38190614-38190636 TTTTAAATGGGTTGGATAGTAGG - Intronic
1010113776 6:72275819-72275841 ATTTGGATAGGGTGCATAGTAGG - Intronic
1010203457 6:73302447-73302469 ATATAGCTTGGGTGTATAGTAGG - Intronic
1010332230 6:74636729-74636751 ATCTATTTGGGGTCTATAGTTGG - Intergenic
1011894614 6:92209913-92209935 TTTTACATGGAGTGTTTACTTGG + Intergenic
1013345723 6:109258362-109258384 ATTTATATGGTGTTTGTAGTTGG + Intergenic
1013991241 6:116256314-116256336 ATTTAGCTTAGGTGTATAGTAGG - Intronic
1014430364 6:121363328-121363350 ATTTACATGGGGTAAATATTTGG - Intergenic
1015725026 6:136290938-136290960 ATTTTCATGGAGTGAATCGTAGG + Intergenic
1016000751 6:139038766-139038788 ATTAACATGGGCTGTAAAGTCGG + Intronic
1016511365 6:144846907-144846929 ATTTACATGGAGAATAAAGTAGG - Intronic
1020623060 7:10541611-10541633 ATTTATATGGGGTGTTTAATAGG - Intergenic
1032700965 7:134378724-134378746 ATTTACATGGGGTGAACACCAGG - Intergenic
1035429813 7:158810732-158810754 ATTTACATGGGATGTCCAGAAGG + Intronic
1041781407 8:61580937-61580959 AGTTGCATGGGGTGCATACTAGG - Intronic
1043393677 8:79815832-79815854 ATTTACTTGGGGGAAATAGTGGG - Intergenic
1044811465 8:96067940-96067962 TTTTACATGGGGTTTCTTGTGGG + Intergenic
1046544938 8:115638070-115638092 ATTTACATGGGGTGTATAGTGGG - Intronic
1055668528 9:78576228-78576250 ATTTACATAGGGTGTACACCAGG + Intergenic
1060264514 9:122102756-122102778 ATTTACATGGTGTCTGTAGCTGG - Intergenic
1195934756 X:110114289-110114311 ATTAACATGGGATGAATAGGTGG - Intronic
1197972188 X:132126469-132126491 ATTTAAATGGGGTGGAGGGTGGG - Intronic
1197980697 X:132216411-132216433 AATTACTTGGGGCGTGTAGTAGG - Intronic