ID: 1046554814

View in Genome Browser
Species Human (GRCh38)
Location 8:115761612-115761634
Sequence CTGCAGCCACTGTTGTGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046554809_1046554814 -2 Left 1046554809 8:115761591-115761613 CCACCTCTCCTTCATATCCGACT 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data
1046554808_1046554814 -1 Left 1046554808 8:115761590-115761612 CCCACCTCTCCTTCATATCCGAC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data
1046554805_1046554814 11 Left 1046554805 8:115761578-115761600 CCCCAGGGAGGACCCACCTCTCC 0: 1
1: 0
2: 1
3: 37
4: 367
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data
1046554810_1046554814 -5 Left 1046554810 8:115761594-115761616 CCTCTCCTTCATATCCGACTGCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data
1046554811_1046554814 -10 Left 1046554811 8:115761599-115761621 CCTTCATATCCGACTGCAGCCAC 0: 1
1: 0
2: 0
3: 50
4: 908
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data
1046554807_1046554814 9 Left 1046554807 8:115761580-115761602 CCAGGGAGGACCCACCTCTCCTT 0: 1
1: 0
2: 5
3: 33
4: 294
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data
1046554806_1046554814 10 Left 1046554806 8:115761579-115761601 CCCAGGGAGGACCCACCTCTCCT 0: 1
1: 0
2: 6
3: 27
4: 273
Right 1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046554814 Original CRISPR CTGCAGCCACTGTTGTGGCA CGG Intronic
No off target data available for this crispr