ID: 1046556099

View in Genome Browser
Species Human (GRCh38)
Location 8:115775355-115775377
Sequence TTTGGTCCCACCTTGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 1, 2: 10, 3: 37, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046556099_1046556103 1 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556103 8:115775379-115775401 CTCTGGTACACTTTGTGCTTTGG No data
1046556099_1046556108 26 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG No data
1046556099_1046556106 19 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556106 8:115775397-115775419 TTTGGTGCTCCCATGGGATCAGG No data
1046556099_1046556107 20 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556107 8:115775398-115775420 TTGGTGCTCCCATGGGATCAGGG No data
1046556099_1046556105 13 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556105 8:115775391-115775413 TTGTGCTTTGGTGCTCCCATGGG No data
1046556099_1046556104 12 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556104 8:115775390-115775412 TTTGTGCTTTGGTGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046556099 Original CRISPR TTTGGTCCCACCTTGAGGCA AGG (reversed) Intronic
902032211 1:13431096-13431118 GTTGGTCCCACCTGCAGGCCAGG + Intergenic
902503674 1:16926199-16926221 TGAGGCCCCACCTGGAGGCAGGG + Intronic
902788589 1:18749614-18749636 AGTAGTCCCACCTTGAGGCTGGG + Intergenic
906413080 1:45594997-45595019 TTTTTTCCCCCCTTGAGTCAGGG + Intronic
906420246 1:45659932-45659954 TTTTCCCCCATCTTGAGGCAGGG - Intronic
907607031 1:55828471-55828493 AGTTGTCCCACCTTGGGGCAAGG + Intergenic
908899067 1:68934930-68934952 TTGTGTCCCAGCTTGTGGCACGG - Intergenic
908900281 1:68948561-68948583 TTAGGTCACACTTTGAGGCTAGG - Intergenic
909603086 1:77481034-77481056 ATTCATCCCAGCTTGAGGCAGGG + Intronic
909934021 1:81530293-81530315 ATTTGTGCCACCTTGAGGAAGGG - Intronic
911239367 1:95448811-95448833 TCTGGACCCACCTTGAGCCAGGG - Intergenic
915466804 1:156103069-156103091 CATGGGTCCACCTTGAGGCAAGG - Intronic
915859961 1:159433554-159433576 GTTGGTCCCATCTTCAGACAAGG - Intergenic
915961624 1:160271864-160271886 ATTTGTCCTACCTTGAGGAAAGG + Intergenic
916638071 1:166695360-166695382 TTGCCTCCCATCTTGAGGCAGGG - Intergenic
917485169 1:175448942-175448964 TTTGGTCCTTCCTTGAGTCAGGG + Intronic
919926169 1:202192998-202193020 ATTGGTGCCACCTGGAGGCCGGG - Intergenic
920537827 1:206751412-206751434 TTTGTTGCCAGCTTGTGGCAAGG - Intergenic
920697434 1:208191989-208192011 CTTACTCCCACCATGAGGCAAGG - Intronic
921263521 1:213404147-213404169 GTGGGGCCCACCTTGAGGCAAGG + Intergenic
921789644 1:219275094-219275116 TTGGGTCCCAACTGTAGGCAGGG - Intergenic
923791583 1:237115698-237115720 TTTGTTCTCACCCAGAGGCACGG - Intronic
1064537291 10:16370380-16370402 TGTCACCCCACCTTGAGGCAAGG - Intergenic
1066101574 10:32122726-32122748 TGAGGTCCCACCTTCAGGCCAGG - Intergenic
1067182959 10:44004517-44004539 TGTGGTCTCACCTTTAGCCAAGG - Intergenic
1067524333 10:47029157-47029179 TCAGGTCCCACCCAGAGGCAAGG + Intergenic
1067739268 10:48882154-48882176 TTAGGACCCAGCTTGAGGGAGGG + Intronic
1068013930 10:51489961-51489983 TTTGGCCCCACTTTTAGGGATGG + Intronic
1069226327 10:65949681-65949703 GTTGGTTCCATCTTGAAGCAAGG + Intronic
1069599623 10:69695106-69695128 CATGGTCCCAAATTGAGGCACGG - Intergenic
1072335621 10:94395588-94395610 TGTGGCCCCACCTTAAGGCAAGG - Intergenic
1075301017 10:121324384-121324406 TTTTGTCCCATCTGAAGGCAGGG + Intergenic
1075381049 10:122018961-122018983 AGTGGTCCTACCTTGTGGCAGGG + Intronic
1077958195 11:7044096-7044118 AGTTGTCCCATCTTGAGGCAGGG + Intronic
1079408542 11:20165558-20165580 TCTTGTCCCACCATGAGGCATGG + Intergenic
1081743173 11:45455120-45455142 AGTTGTCCCACCTCGAGGCAAGG - Intergenic
1082142759 11:48629509-48629531 TCTGGTCCTCCCTTCAGGCATGG + Intergenic
1082569958 11:54726875-54726897 TCTGGTCCTCCCTTCAGGCATGG + Intergenic
1083230946 11:61318901-61318923 TTAGGTCCCAACTTTAGGCTAGG + Intronic
1083331415 11:61900142-61900164 GTTGATTCCACCCTGAGGCAAGG - Intronic
1085287061 11:75369951-75369973 CCTGGTGCCACCTTGAGACAGGG - Intergenic
1085949250 11:81309438-81309460 TTTGATCCCACCTTGAGGGAAGG - Intergenic
1089620389 11:119718658-119718680 TCTGGTCTCACCGTGAGACATGG + Intronic
1090089552 11:123682908-123682930 ATTGGCCCCTCCTTGAGGGATGG - Intergenic
1093194623 12:16115436-16115458 AGTTGTCCCACCTTGAGGCAAGG - Intergenic
1097056489 12:56253112-56253134 CTTGGTCCCTCCTTGACCCAAGG - Intronic
1097130902 12:56810143-56810165 TGAGGCCCCACCTTGAGGCCAGG - Intergenic
1097987232 12:65796843-65796865 TTTTTTCCCACCCTGAGGCAGGG + Intergenic
1100105918 12:91171830-91171852 TTTGCTCACAACTTGAGGTATGG - Intronic
1100475454 12:94931560-94931582 ATAGGTCCCACATTGAGGCCAGG + Intronic
1101826400 12:108223839-108223861 GTTGGCCCCACCTTAAGGAAAGG - Intronic
1101853817 12:108425666-108425688 TTAGGTCCCACCTTGAGGCAAGG + Intergenic
1103201330 12:119090468-119090490 ATTGGTCTGACCTTGAGGCAAGG + Intronic
1103318840 12:120078510-120078532 TTAGGTCCCACCTTGCAGGAGGG + Intronic
1103437443 12:120937704-120937726 AATCCTCCCACCTTGAGGCAAGG - Intergenic
1105336315 13:19473306-19473328 TTTGGATCCACCTGGAGGCTAGG - Intronic
1106060000 13:26281066-26281088 TTTTCTCCTACCTTGAAGCAGGG - Intronic
1108456991 13:50626200-50626222 TTTGGTCAGAACTTCAGGCATGG + Intronic
1112742182 13:102487358-102487380 TCTGATTCCACCTTGAGGAAAGG - Intergenic
1114360632 14:21968371-21968393 ATTCCTCCCACCCTGAGGCAAGG + Intergenic
1115817593 14:37179310-37179332 ATTGGTCCCACCTTAAGGCAAGG - Intergenic
1115891061 14:38029569-38029591 GTTGGTTCCACCTTTAGTCAGGG - Intronic
1117573214 14:57069915-57069937 ATTGGTCTCACACTGAGGCATGG - Intergenic
1118864311 14:69690954-69690976 TGGGGTCCCACCATGAGACAGGG - Intronic
1120731056 14:88002126-88002148 TGTGGTCCCAGCTTCTGGCAAGG + Intergenic
1120915000 14:89702900-89702922 ATTTATCCCAACTTGAGGCAAGG + Intergenic
1121553394 14:94819249-94819271 TAAGGCCCCACCTTGAGGCCAGG - Intergenic
1121681321 14:95794999-95795021 GCTGGTCCCACCTCGAGGCAAGG + Intergenic
1122487946 14:102094362-102094384 TTTGCTCCCACTTTGACCCAGGG - Intronic
1202891431 14_KI270722v1_random:162795-162817 TCTCATCCCACATTGAGGCAGGG - Intergenic
1124614440 15:31231377-31231399 TTTGGTCCCACCCAGAAGCCTGG + Intergenic
1125329291 15:38566063-38566085 TTTGGTCCCACCTGTAGCAAGGG - Intergenic
1126422304 15:48487537-48487559 AGTTGTCCCACCTTGAGACAAGG - Intronic
1126725114 15:51623416-51623438 TTTGCTCCCACCTTTTGTCACGG + Intergenic
1127170170 15:56292809-56292831 AATTGACCCACCTTGAGGCAAGG - Intronic
1128441340 15:67711861-67711883 CTTGGTCCCACCTTGACTCCTGG - Intronic
1128550471 15:68595229-68595251 CTTTGTCCCAACCTGAGGCAGGG - Intronic
1133328386 16:4956328-4956350 TTTGCTGCCACCTTGCGACAGGG + Intronic
1133893462 16:9903357-9903379 TTTGGTCCCACCAGGAGCAAAGG + Intronic
1133943014 16:10326123-10326145 TTAGGTCCTACTTTCAGGCAAGG + Intergenic
1133944738 16:10338765-10338787 TCTGGGCCCACCTTTAGACAGGG - Intronic
1134027763 16:10967490-10967512 TGTGGTCCCAGCTTGAGGCCAGG - Intronic
1134377455 16:13690690-13690712 GTTAATCCCACCTTGAGGCAAGG - Intergenic
1135591212 16:23706291-23706313 TCTGGTCCCATCTTGGAGCAAGG - Intronic
1135631446 16:24038848-24038870 GTCAGTCCCATCTTGAGGCAAGG + Intronic
1140036548 16:71375805-71375827 GTGGGTCCCACTTTGAGGCAAGG + Intronic
1141468603 16:84223216-84223238 TTTGGCCACACCTAGCGGCAAGG - Intronic
1144633395 17:16887773-16887795 TTTGATCCCACTTTGAGACATGG - Intergenic
1146932106 17:36784821-36784843 GTTGGTCCCTCCTTGAGGCAAGG + Intergenic
1148349457 17:46929356-46929378 TTAGGTCCCACGTTTTGGCATGG - Intronic
1148914406 17:50962572-50962594 TTTGGTCCCACTTTGTAACATGG - Exonic
1156298797 18:35817775-35817797 TAAGGCCCCACCTTCAGGCAGGG - Intergenic
1156578851 18:38351728-38351750 GTTGGTCCCATACTGAGGCAAGG + Intergenic
1158670180 18:59467610-59467632 TTTGTTTCCACCATGCGGCAGGG - Intronic
1160292805 18:77609451-77609473 TAAGGTCCCACCTTCAGGCCAGG + Intergenic
1161614371 19:5261717-5261739 TGAGGTCCCATCATGAGGCAGGG + Intronic
1161880509 19:6947863-6947885 GTTGGTCTCACTTTGAGTCAAGG + Intergenic
1163314543 19:16532953-16532975 CTTGGTCCCTCCCTGAGGCAGGG - Intronic
1163795254 19:19334263-19334285 TGTGGTCCCCTCTTGTGGCACGG - Intronic
1167326325 19:48828388-48828410 TGTAATCCCAGCTTGAGGCAAGG + Intronic
925129116 2:1481895-1481917 CTTGGTCCAGCCTTGAGGTAGGG - Intronic
926859304 2:17291851-17291873 TGAGGTCCCACCTTCAGGCCAGG - Intergenic
930005369 2:46892251-46892273 GGAGGCCCCACCTTGAGGCAGGG + Intergenic
933682567 2:85114995-85115017 ATTTGCCCCACATTGAGGCAAGG - Intergenic
935484721 2:103639575-103639597 TTTGGTCCCAGGTTGAGGGTTGG + Intergenic
936430637 2:112459379-112459401 GTTGGTCTCCCCTAGAGGCAAGG - Intergenic
936524970 2:113235932-113235954 CCTGGGCCCACCTTGAGGCCCGG + Intronic
936525047 2:113236154-113236176 CCTGGGCCCACCTTGAGGCCCGG + Intronic
936525125 2:113236375-113236397 CCTGGGCCCACCTTGAGGCCCGG + Intronic
937159493 2:119746734-119746756 TGTGGCCACACCTTGATGCAAGG - Intergenic
938903868 2:135820696-135820718 TTTTGTCCCACCCTAAGGGATGG + Intronic
939113492 2:138034330-138034352 GCTCGTCCCACCTTGAGGCAAGG - Intergenic
940127697 2:150345180-150345202 ATTTGTCCCACCTTAAAGCAAGG + Intergenic
941317637 2:164014474-164014496 ATTAGTCACACTTTGAGGCAGGG + Intergenic
942381815 2:175399544-175399566 TGTGGTGCCACCTTAAGCCAAGG - Intergenic
945093558 2:206198513-206198535 TTTGGTGCTAGTTTGAGGCATGG - Intronic
946676273 2:222162939-222162961 TGCTGTCCCACCTTGAGGAAAGG - Intergenic
947247559 2:228066415-228066437 TTGGGTCTCACCTTGACACAAGG + Intronic
947462227 2:230313466-230313488 TTTGGTCCTGCTTTCAGGCAAGG - Intergenic
947567764 2:231205567-231205589 TTTGGGTACACCTTGAGGGAGGG + Intronic
1169291117 20:4353834-4353856 TTTGGCCCCACATTCAGCCAGGG + Intergenic
1170016113 20:11784130-11784152 GTTGGTCCCACCTTGAGACAAGG + Intergenic
1170031926 20:11953145-11953167 TTTGGTCATACCTGGATGCAAGG + Intergenic
1170055826 20:12201506-12201528 TTATGTCCCAAATTGAGGCAAGG - Intergenic
1170087491 20:12550938-12550960 TTTGGAACCACCTTGAATCAAGG - Intergenic
1170089432 20:12574241-12574263 GTTCATCCCACCTTGAGGCAAGG + Intergenic
1170465336 20:16617871-16617893 GTTAGTCCCACCTGGAGACAAGG + Intergenic
1170582798 20:17711619-17711641 GTTGGCTCCACCTTGAGACAAGG + Intronic
1170624087 20:18018294-18018316 AGTTGTCCCACCTTGAGGCAAGG - Intronic
1173118379 20:40268122-40268144 AGAGTTCCCACCTTGAGGCAAGG + Intergenic
1173324009 20:42016414-42016436 TTAGGTCCCACCTCAAGGCAAGG + Intergenic
1173353864 20:42269035-42269057 GTTGGGCCCACCTTGAGGCAAGG - Intronic
1173404521 20:42753177-42753199 TTTGGTCACACCTGGAGGGCTGG - Intronic
1177918528 21:27122605-27122627 AGTTGGCCCACCTTGAGGCAAGG - Intergenic
1178376973 21:32074985-32075007 TATTGCCCCTCCTTGAGGCAGGG - Intergenic
1179104293 21:38384202-38384224 GTTGGTCTTTCCTTGAGGCAAGG - Intronic
1180563239 22:16639332-16639354 TTTGGATCCACCTGGAGGCTAGG + Intergenic
1180983044 22:19888315-19888337 TCTGGTCCCTCCTTGGGGCCAGG - Intronic
1181049468 22:20231750-20231772 TCTGTTTCCACCTTGATGCATGG + Intergenic
1182230157 22:28831739-28831761 GTTGGCCCCACCTTGAGGTCAGG - Intergenic
1183316896 22:37141867-37141889 TGAGGTCCCACCTTCAGGCTGGG + Intronic
1183531889 22:38360812-38360834 TTTGGATCCACCTGGAGGCTAGG - Intronic
949333154 3:2944942-2944964 AATGGTCTTACCTTGAGGCAAGG + Intronic
949834169 3:8249968-8249990 TTTGGTCCTACCTGGAAACAAGG - Intergenic
950243259 3:11391198-11391220 TTTGCTCACATCTTGAGGCCAGG - Intronic
950554302 3:13685997-13686019 TTTTGTCCCCCCTTCAGGCAGGG - Intergenic
950655730 3:14435132-14435154 CTTGGTGCCACCCTGGGGCAAGG - Intronic
950834136 3:15903179-15903201 AGTTGTCCCACCTTGAGGCAGGG + Intergenic
951116516 3:18869474-18869496 GTTAGGCCCACCTTGAGGCAGGG + Intergenic
951136249 3:19107370-19107392 TGTGGCCCCACCTTCAGGCCAGG - Intergenic
951755945 3:26091358-26091380 TTTGGTCCCCACTTGAAGCAGGG - Intergenic
952423042 3:33148510-33148532 GTTGGTCCCACCTTGAGGAAAGG + Intergenic
952760073 3:36905704-36905726 GCTGGTTCCATCTTGAGGCAAGG - Intronic
952792884 3:37214346-37214368 GTGAGTCTCACCTTGAGGCAAGG + Intergenic
952983376 3:38756321-38756343 GTTAGTCCTACCTTGAGGCAAGG - Intronic
953010014 3:39016187-39016209 ATCTGTCCCACTTTGAGGCAAGG + Intergenic
953239714 3:41137934-41137956 GTTTGGCCCAACTTGAGGCAAGG + Intergenic
954036478 3:47853640-47853662 TTTGGTACCAGCCTGAGGCCTGG - Intronic
955858528 3:63300695-63300717 GTTGGTCCCACCCTGAGGCAAGG - Intronic
957089036 3:75709916-75709938 TCTCATCCCACATTGAGGCAGGG + Intronic
957381933 3:79442696-79442718 GTTGGTTCCACCATGAGGAAAGG - Intronic
957990799 3:87625243-87625265 GTTGGCCCCATCCTGAGGCAAGG + Intergenic
958638498 3:96776630-96776652 TTTGGTTCCACCTTCAGGATTGG + Intergenic
958821405 3:98977756-98977778 CTTGGTGCCAAGTTGAGGCAGGG - Intergenic
961934495 3:130569049-130569071 GTTGGTCCTACCTTGAGGCGAGG + Intronic
965501030 3:169456721-169456743 TGTGGTCCCACCTTTACGGAGGG - Intronic
967259764 3:187630599-187630621 GTCAGTCCCACCCTGAGGCAAGG + Intergenic
969856552 4:10004366-10004388 TATGGCCCCACCTAGATGCAAGG - Intronic
970302364 4:14694666-14694688 TTTTGTACCATCTTCAGGCAGGG - Intergenic
971094162 4:23379474-23379496 TGTTGTTCCACTTTGAGGCAAGG - Intergenic
973193664 4:47415375-47415397 TTTGGGACCACCATGAGGGAAGG - Intronic
975719055 4:77232915-77232937 TTTGTTGCCACCATGAGGTAAGG - Intronic
975856814 4:78633317-78633339 TGTGGTTCCACCTAAAGGCAAGG + Intergenic
976472691 4:85447933-85447955 ATTTGTCCTACTTTGAGGCAAGG + Intergenic
979540650 4:121877400-121877422 GTTGGCCCCATCTTGAGACAAGG + Intergenic
982466556 4:155740119-155740141 TTTGATTCCACTTGGAGGCAGGG - Intergenic
983106649 4:163694466-163694488 CTTTGTCCCCTCTTGAGGCAAGG - Intronic
984257534 4:177406552-177406574 TTTGCTGCCACCTTGAAGAAAGG - Intergenic
984580328 4:181503135-181503157 GGAGGTCCCACCTTGAGGCCGGG + Intergenic
984908359 4:184649683-184649705 TTTGGTCCCGCCCTGAGGCTCGG + Exonic
987121585 5:14772958-14772980 AGTGGTCCCACTTGGAGGCAGGG - Intronic
987122429 5:14779504-14779526 TCTGTTACCTCCTTGAGGCAGGG + Intronic
988362832 5:30257172-30257194 TTTGTTCTCACCTGGAGGAAAGG - Intergenic
988825787 5:34932999-34933021 CTGGGTACCACCCTGAGGCAAGG + Intronic
990740555 5:58908352-58908374 GTTAATCCCACCTTGAGTCAAGG + Intergenic
991713286 5:69429157-69429179 TTCTGTCCCACCTAGAGCCATGG + Intronic
993002879 5:82399900-82399922 ATTGGTCCCATCTTAAGGCAGGG - Intergenic
995183378 5:109249106-109249128 GCTGGTACCACTTTGAGGCAAGG + Intergenic
998063104 5:139134559-139134581 TTTGGTCCTCATTTGAGGCATGG - Intronic
999387456 5:151164683-151164705 TTTGTTTCCACCTGGAAGCAAGG - Intergenic
999734392 5:154501841-154501863 ATTTGTCCCACCTAGAGGCAAGG - Intergenic
1001174149 5:169449630-169449652 TATTGTCCCATCTAGAGGCAAGG - Intergenic
1003564126 6:7208203-7208225 TTTGGCCACAGCTTGAGGGAAGG + Intronic
1004131983 6:12929169-12929191 GTTGGTCCCAGCTTTAGGCAAGG - Intronic
1004520813 6:16359210-16359232 TTAGGCCCCACCTTCAGGCGAGG + Intronic
1005560442 6:27035012-27035034 GTTAGTCCCACCTTCAGGCAAGG - Intergenic
1011142205 6:84171000-84171022 GTTGGTCCCTGCTTGAGGCAAGG - Intronic
1012052295 6:94361390-94361412 TGAGGCCCCACCTTCAGGCAAGG - Intergenic
1012524424 6:100160341-100160363 GATGGTACCACCTAGAGGCAAGG + Intergenic
1012940549 6:105410209-105410231 TCTGGTCACACCTGGAGGCTGGG + Intergenic
1014786252 6:125623326-125623348 AGTTGTCCCACCTTGAGGCCAGG + Intergenic
1016186358 6:141202391-141202413 TTTGGTCTCAACTTGAAGCAAGG + Intergenic
1016199984 6:141395035-141395057 TGAGGTCCCACCTTCAGGCCAGG + Intergenic
1017251665 6:152286737-152286759 TCTGTTCCCACTTTGAGGCATGG + Intronic
1019882522 7:3875457-3875479 TTTAGTCCCACATAGAGGAAAGG + Intronic
1023303331 7:38797096-38797118 TTTGGTGCCACCTTGTGGCTTGG - Intronic
1029636892 7:101790611-101790633 GGTTGTCCCACCCTGAGGCATGG + Intergenic
1030615743 7:111736411-111736433 TTTTGTGTGACCTTGAGGCAGGG + Intronic
1032386413 7:131528631-131528653 TTTGGTGCCAAATTGAGGCATGG + Intronic
1036766875 8:11554972-11554994 ATTGGTGCCACCTTGGGGGATGG + Intronic
1039805255 8:40992293-40992315 TTTTTTCCCACCTTGAGAAAAGG + Intergenic
1040938961 8:52813081-52813103 TTTGGGGCCACCTTGAGTCTAGG + Intergenic
1042113807 8:65410038-65410060 TTTTGTCCCTTTTTGAGGCAAGG - Intergenic
1042430720 8:68703464-68703486 GCTTGTCCCACCTTGAAGCATGG - Intronic
1042813601 8:72853319-72853341 GCTGGTCCCACCTGGAGGCAAGG - Intronic
1045242457 8:100414562-100414584 GTTGGCCCCACCTTGAGGCAGGG - Intergenic
1046191866 8:110806537-110806559 TTTGGTTCCTCATTGAGGCAAGG + Intergenic
1046556099 8:115775355-115775377 TTTGGTCCCACCTTGAGGCAAGG - Intronic
1047968801 8:130067336-130067358 AATGGTCCCACCCTGAGACAAGG - Intronic
1048394569 8:134001899-134001921 GTTTGTCCTGCCTTGAGGCAAGG - Intergenic
1050725476 9:8643899-8643921 TGAGGTCCCACCTTCAGGCCAGG + Intronic
1051127017 9:13815943-13815965 ATTGGCCCTACCTTGAGACAAGG + Intergenic
1053448551 9:38172772-38172794 TTTGTTCCCAGGCTGAGGCAAGG + Intergenic
1055694563 9:78870100-78870122 AGTAGTCCCACCTTAAGGCATGG + Intergenic
1057501830 9:95602442-95602464 GCTGGTCCCACCTTGAGGCAGGG + Intergenic
1058278471 9:103078771-103078793 TTTAGCTCCACCTTGAGGAAAGG - Intergenic
1059253363 9:112906975-112906997 TGTTGCCCCACCTTGAGGCCAGG + Intergenic
1061267341 9:129514454-129514476 TGAGGTCCCACCTTCAGGCCAGG + Intergenic
1061887251 9:133598044-133598066 TTGGGTCCCAACCTGAGCCATGG + Intergenic
1062461492 9:136664323-136664345 CTTGGTCCTACCTTGGTGCATGG - Intronic
1062583506 9:137238401-137238423 GTAGGTCCCACCCTGAGCCAAGG - Intergenic
1186442251 X:9596460-9596482 TTTGGTGTCACCTTGGGGGAGGG + Intronic
1187082176 X:16002446-16002468 GTTTGTTCCACCTTTAGGCAAGG + Intergenic
1187106670 X:16250259-16250281 ATTTGTCCCACCTTGAGGAAAGG - Intergenic
1187179877 X:16934234-16934256 GTCGGTCCCACTTTGAGTCAAGG + Intergenic
1187250625 X:17594856-17594878 GTTGATCCCACCTTGAAGTAGGG + Intronic
1189682133 X:43527616-43527638 GTGTGTCCCACCTGGAGGCAAGG + Intergenic
1189773721 X:44451421-44451443 ATCAGTCACACCTTGAGGCAAGG - Intergenic
1190296191 X:49029353-49029375 GTTGGTCCCAGGTTAAGGCAGGG + Exonic
1190998820 X:55637661-55637683 TAAGGTCCCACCTTCAGGCCAGG + Intergenic
1191797484 X:65035687-65035709 TGTGTTCAAACCTTGAGGCATGG - Intergenic
1194379333 X:93175064-93175086 TCTGGCCCCACCTTCAGGCTAGG + Intergenic
1196752723 X:119132054-119132076 TTTGTTCCCCCTCTGAGGCAGGG - Intronic
1198993495 X:142544976-142544998 GTTGGTCCCACCTTGAGGAAAGG - Intergenic
1199917844 X:152363500-152363522 ATTTGTCCTACTTTGAGGCAAGG - Intronic
1202595505 Y:26535084-26535106 TTTGGATCCACCTGGAGGCTAGG + Intergenic