ID: 1046556100

View in Genome Browser
Species Human (GRCh38)
Location 8:115775360-115775382
Sequence AGAGCTTTGGTCCCACCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046556100_1046556103 -4 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556103 8:115775379-115775401 CTCTGGTACACTTTGTGCTTTGG No data
1046556100_1046556104 7 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556104 8:115775390-115775412 TTTGTGCTTTGGTGCTCCCATGG No data
1046556100_1046556106 14 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556106 8:115775397-115775419 TTTGGTGCTCCCATGGGATCAGG No data
1046556100_1046556108 21 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG No data
1046556100_1046556105 8 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556105 8:115775391-115775413 TTGTGCTTTGGTGCTCCCATGGG No data
1046556100_1046556107 15 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556107 8:115775398-115775420 TTGGTGCTCCCATGGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046556100 Original CRISPR AGAGCTTTGGTCCCACCTTG AGG (reversed) Intronic
902916085 1:19640593-19640615 AGAGGTTTGGACCCCCGTTGAGG + Intronic
902920256 1:19661920-19661942 AGGGTTATGGTGCCACCTTGTGG - Intergenic
903744105 1:25575119-25575141 AGAGCCCTGGTCCAGCCTTGCGG - Intergenic
907595965 1:55720246-55720268 AGAGCTTTGTTCCCACGCAGAGG + Intergenic
909253934 1:73393910-73393932 AGGGCATTAATCCCACCTTGAGG + Intergenic
910264176 1:85321257-85321279 ACAGCTTAGGTACCACCTCGAGG + Exonic
911669720 1:100593854-100593876 AGAGCCTAGGTCTCAACTTGGGG + Intergenic
911943955 1:104082453-104082475 AGAGTTAGGGTTCCACCTTGAGG - Intergenic
913133444 1:115863928-115863950 AGGCCTCTGGTCCCACCTTAGGG - Intergenic
913456045 1:119031840-119031862 AGAACTTGGGACCCGCCTTGGGG + Exonic
916707139 1:167362760-167362782 AGGGCTTTGGGACCACCTAGGGG + Intronic
921070683 1:211655374-211655396 AGAGCCATGGCGCCACCTTGCGG + Intergenic
922459866 1:225807757-225807779 ACAGCTTTGGCCACACCTGGTGG + Intergenic
1064347281 10:14543893-14543915 ACAGCTCTTGTCCCACCCTGAGG + Intronic
1064560721 10:16593149-16593171 AGAGCTTTGTTCCCTGCTTTTGG + Exonic
1065306195 10:24371287-24371309 AGAGGTTTGGTTCCACCTAGAGG - Intronic
1066660759 10:37736767-37736789 AGAGCAGTGATCCCACCATGAGG + Intergenic
1067303346 10:45034604-45034626 AGAGCTTGGTTCTCACCTGGAGG - Intergenic
1069886182 10:71625217-71625239 AAAGGTTTGGTCCCACCGAGCGG + Intronic
1071439304 10:85676344-85676366 ACAGATTTGATCCCACCCTGAGG - Intronic
1074955552 10:118384995-118385017 AGAATTTTGGCCCCACCCTGGGG + Intergenic
1075017140 10:118918161-118918183 AGAGCTTTGGTGCCACAGTCTGG - Intergenic
1077674122 11:4182271-4182293 GGTGCTTGGGTGCCACCTTGTGG - Intergenic
1079409789 11:20176674-20176696 AAAGCTTTCCTCCCACCTGGTGG + Intergenic
1081949109 11:47027474-47027496 AGAGCACTGGTCCTACCCTGGGG - Intronic
1084067500 11:66713615-66713637 ATAGCTCTGGCCCCACCTTCGGG + Exonic
1084460635 11:69294832-69294854 CTAGCTTTGGCACCACCTTGGGG - Intronic
1085340533 11:75728432-75728454 AGAGCTGTTCTCCCTCCTTGGGG + Intronic
1086351331 11:85945041-85945063 AGAGCACAGGTGCCACCTTGGGG - Intergenic
1093211948 12:16318317-16318339 AGTGCTTTCCTTCCACCTTGTGG + Intergenic
1094087251 12:26607689-26607711 AGAGCTTTGCTCCTGACTTGAGG - Intronic
1094495555 12:30987249-30987271 GGAGGTCTGGTCCCACCTGGAGG - Intronic
1096574341 12:52543366-52543388 TGAGCTGGGGTCCCACCATGGGG - Intergenic
1101594812 12:106154820-106154842 TGATTTATGGTCCCACCTTGAGG - Intergenic
1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG + Intergenic
1106572088 13:30935820-30935842 AGAGTTTTTGTCCCGCATTGAGG - Intronic
1107302398 13:38979200-38979222 AAAGCTTTGGACCCACATGGAGG + Intronic
1107365990 13:39676488-39676510 AGATCTTTGCTGCCACCTGGAGG + Intronic
1108461477 13:50671618-50671640 AGATCTTTGGTCCCACCTTTTGG - Intronic
1108526005 13:51286569-51286591 GAAGCTTTGGTGCCACCTGGTGG + Intergenic
1109282511 13:60373040-60373062 AGAGCTTTGGTCTCCCATAGAGG + Intergenic
1110778037 13:79432776-79432798 AGAGTTTTTGTCCCACCTCCAGG - Intergenic
1111644713 13:91017516-91017538 GGGGCTTTGGCCCCACCTGGTGG + Intergenic
1111654443 13:91134396-91134418 TGAGTTCTGGTGCCACCTTGTGG - Intergenic
1111908545 13:94284049-94284071 AGAACTTCCTTCCCACCTTGGGG - Intronic
1114255573 14:20998894-20998916 AGAGATTTGGGGCCACCTGGAGG - Intergenic
1122659842 14:103287854-103287876 AGAGCTTCGCTCCCTCCTGGGGG - Intergenic
1123008182 14:105334335-105334357 AGAGAGCTGTTCCCACCTTGAGG + Intronic
1123436339 15:20257235-20257257 AGAGCCTTGGCCCCGCCTGGTGG - Intergenic
1124600905 15:31132179-31132201 AGAGCTTGTGCCCAACCTTGGGG - Intronic
1124666287 15:31595723-31595745 AGAGCCGTGGTCCCTCCTGGAGG + Intronic
1125246728 15:37649183-37649205 AGAGAGTTTGTCTCACCTTGAGG + Intergenic
1125314277 15:38414538-38414560 GGAGCTGTGGTCCCCCCTAGTGG + Intergenic
1127884502 15:63187784-63187806 AGAGCTTTGTTCCTATCTAGTGG + Intergenic
1128482446 15:68051421-68051443 AGAGCTTTTATTCCACCTAGTGG + Intergenic
1130217923 15:81989579-81989601 AGAGAGTCAGTCCCACCTTGGGG - Intergenic
1131041863 15:89275829-89275851 TGAGGTTTGGTCCCACCCAGTGG - Intronic
1131106771 15:89740231-89740253 GGAGCTATGGTGCCACCTAGTGG - Intronic
1131694749 15:94864516-94864538 AGTGTTTTTGTCCCACCTTTTGG + Intergenic
1136161126 16:28419466-28419488 TGATCTATGGTCCCACCCTGTGG - Intergenic
1136201839 16:28695525-28695547 TGATCTATGGTCCCACCCTGTGG + Intronic
1136218182 16:28809717-28809739 TGATCTATGGTCCCACCCTGTGG + Intergenic
1136848235 16:33593630-33593652 AGAGCCTTGGCCCCGCCTGGAGG + Intergenic
1139674412 16:68513218-68513240 AGAGACATGGTTCCACCTTGAGG - Intergenic
1139690829 16:68641009-68641031 AGAACTTTGGCCCCTACTTGGGG - Intronic
1140514395 16:75531706-75531728 ACAGCTCTGTTCCCACCCTGGGG - Intronic
1203109942 16_KI270728v1_random:1442279-1442301 AGAGCCTTGGCCCCGCCTGGAGG + Intergenic
1143794124 17:9322507-9322529 AGAGCTCTGGTCCCACCCCCTGG - Intronic
1143916321 17:10295918-10295940 AGAGCTTTGCTGCCACCTCCTGG - Intergenic
1146932105 17:36784816-36784838 AGAGAGTTGGTCCCTCCTTGAGG + Intergenic
1157525153 18:48374937-48374959 AGAGCTTGGGTCCCACCCTCAGG - Intronic
1159871135 18:73760554-73760576 ACAGGTTTCTTCCCACCTTGAGG + Intergenic
1161437795 19:4273895-4273917 AGAGATATGGCCCTACCTTGAGG - Intergenic
1162500396 19:11050268-11050290 AGAGCTCTGGCCCCACCAGGCGG + Intronic
1163574530 19:18102934-18102956 CAAGCTTTAGCCCCACCTTGAGG - Intronic
1165730889 19:38143910-38143932 ACAGCTTTGGCCCCTCCCTGTGG + Intronic
926688755 2:15718345-15718367 ACAGCTCTGCTCCCAGCTTGGGG - Intronic
928612426 2:33003636-33003658 AGAGCTTCCTTCCAACCTTGTGG + Intronic
929060700 2:37921986-37922008 AGAGCTTCGGTTACACCTGGGGG + Intergenic
929455560 2:42062328-42062350 AGAGTATATGTCCCACCTTGTGG - Intergenic
930946585 2:57083879-57083901 AGAACTTGGGACCCACCCTGTGG - Intergenic
930960805 2:57259286-57259308 AGAGCTTTGTTTCAACCTTATGG - Intergenic
933899054 2:86836178-86836200 AGGGCTGTGCTCCCAGCTTGTGG + Intronic
935221008 2:101012833-101012855 AAAGCTTTGCTGCCATCTTGTGG - Intronic
936919258 2:117670857-117670879 CGGGCATTGGTCCCACCATGAGG + Intergenic
937047410 2:118859069-118859091 GGAGCTCGGGTCCCACCTTGAGG + Intergenic
938110913 2:128564346-128564368 AGAGCTGGGGTCCTACCTTCAGG + Intergenic
938489579 2:131754679-131754701 AGGGCTTTCTGCCCACCTTGGGG - Intronic
938659867 2:133474994-133475016 AGAGCTGTGGTTTCACCATGCGG + Intronic
938801448 2:134766984-134767006 AGAGTCTTGGTCCCACCTGCAGG - Intergenic
942542467 2:177028783-177028805 AGAGCTTAGGTACTTCCTTGGGG - Intergenic
942586065 2:177479267-177479289 AGAGCTTTTGTCCCACAGTTGGG + Intronic
942783370 2:179672108-179672130 GGAGCTGTGGTCCCACCTTCTGG - Intronic
943819265 2:192299370-192299392 AGAGCTTTTATCCCAAGTTGAGG - Intergenic
945159724 2:206877088-206877110 TGAGCTTAGGTTCCACTTTGGGG + Intergenic
946526330 2:220524695-220524717 ATAGCTTTGTGCCCTCCTTGTGG - Intergenic
1173353865 20:42269040-42269062 AAAGAGTTGGGCCCACCTTGAGG - Intronic
1176999008 21:15588892-15588914 AGAGATTTGGTCTCACAATGTGG + Intergenic
1179288881 21:40001174-40001196 TGAGCTCTGGTCCCATCTTAAGG - Intergenic
1181604313 22:23971105-23971127 AGAGGTCTGGTCCCATTTTGGGG + Intronic
1182946229 22:34325039-34325061 AGGGTTTTGGTCCCAACTTTGGG + Intergenic
1183753400 22:39735909-39735931 AGGCCTATGGTCCCACCCTGCGG - Intergenic
949809573 3:7991762-7991784 AGAGTTTGGGTACTACCTTGGGG - Intergenic
950708399 3:14797949-14797971 ACAGCATGAGTCCCACCTTGAGG - Intergenic
951116514 3:18869469-18869491 AGAGAGTTAGGCCCACCTTGAGG + Intergenic
952007415 3:28857887-28857909 AGAGCCTGGGTCCCACATTCTGG + Intergenic
952825417 3:37520706-37520728 AGAGCTTTGGGCACAGTTTGGGG + Intronic
954135513 3:48580394-48580416 AGAGCTTTGGAAGCACCATGAGG + Intronic
954361759 3:50125967-50125989 AGAGCTTTGATTCCACCTGTGGG + Intergenic
961350484 3:126298378-126298400 AGAGATTTTCTCCCACTTTGCGG + Intergenic
961934494 3:130569044-130569066 ACAGAGTTGGTCCTACCTTGAGG + Intronic
963567127 3:146944081-146944103 AGAGCTTTATTCCCACTATGTGG + Intergenic
964578101 3:158197896-158197918 AGAGCTTTATTCCCACTATGTGG + Intronic
975213982 4:71732897-71732919 AAACCTTTGCTTCCACCTTGTGG - Intergenic
980897185 4:138871207-138871229 AGACCTTTGGCCCCATCTAGTGG + Intergenic
982097065 4:151933029-151933051 TGAGCTTATGGCCCACCTTGGGG + Intergenic
982925935 4:161336964-161336986 AAAGCTTTGGGCCAAGCTTGAGG + Intergenic
985393394 4:189515076-189515098 AGATCTTTGGGGCCAACTTGAGG + Intergenic
987179482 5:15352311-15352333 AGAGTTTTGGTCCCAAATTTAGG + Intergenic
1000249411 5:159479800-159479822 AGAGCTTTGGTCAGACCCTGTGG + Intergenic
1000669216 5:164039839-164039861 AGTGCTTTGGCCCCACCTCCAGG + Intergenic
1001689703 5:173623934-173623956 AGAGCTTTTGTCTCAACTAGAGG - Intergenic
1007204017 6:40134228-40134250 ACAGCTTGAGTCCCAGCTTGGGG - Intergenic
1015357833 6:132300518-132300540 AAAGCTGTCGTGCCACCTTGTGG - Intronic
1017683745 6:156890621-156890643 AGAGCCATGGACCCAGCTTGTGG + Intronic
1020691325 7:11358151-11358173 ATAACTTAGCTCCCACCTTGGGG + Intergenic
1021731223 7:23597428-23597450 CGAGGTTTGTTCCCAGCTTGTGG - Exonic
1023008808 7:35906618-35906640 AGAGTTTTGCTGCCACCTAGTGG + Exonic
1023303332 7:38797101-38797123 GGTGTTTTGGTGCCACCTTGTGG - Intronic
1023840787 7:44096447-44096469 TGAGCTTGGGTTCCAACTTGTGG - Intergenic
1024338458 7:48233389-48233411 AGAGATTTTGTCATACCTTGGGG + Intronic
1025575335 7:62632241-62632263 AGATATTTGGTGCCACATTGAGG - Intergenic
1025581645 7:62726850-62726872 AGATATTTGGTAGCACCTTGAGG + Intergenic
1027799074 7:82729590-82729612 AGAGTTATACTCCCACCTTGTGG + Intergenic
1033242250 7:139690015-139690037 ATAGATTGGGCCCCACCTTGAGG - Intronic
1033441718 7:141386147-141386169 AAAGCTTTGCTCCCATCTTCTGG + Intronic
1033713477 7:143974719-143974741 AGAACTTTGATCCCACTTTATGG - Intergenic
1038521435 8:28235714-28235736 AGAGCATTGGGGGCACCTTGTGG - Intergenic
1039053466 8:33515039-33515061 AGTATTTTCGTCCCACCTTGGGG + Intergenic
1042100464 8:65270855-65270877 TGTGCATTGGTCCCCCCTTGAGG - Intergenic
1042225597 8:66512357-66512379 AGAGCTGCTGTGCCACCTTGTGG - Intronic
1043800578 8:84604903-84604925 AGCTCTTTGGTGCCACCATGTGG + Intronic
1046012421 8:108565611-108565633 AGAGCCTTGTTACCACCTAGTGG + Intergenic
1046556100 8:115775360-115775382 AGAGCTTTGGTCCCACCTTGAGG - Intronic
1048813592 8:138310402-138310424 AGAGCAGTGCTCCCAGCTTGAGG - Intronic
1049374148 8:142281119-142281141 TGAGCTGTGGCCTCACCTTGGGG - Intronic
1050385014 9:5080307-5080329 GGAGTTTTGGTACCACTTTGTGG + Exonic
1052053197 9:23872962-23872984 AAAGATTTGCTCCCACTTTGTGG - Intergenic
1053410173 9:37911149-37911171 AGAGCTGTGGTCTCAACTTCAGG + Intronic
1057501828 9:95602437-95602459 ACAGCGCTGGTCCCACCTTGAGG + Intergenic
1060774725 9:126364678-126364700 TTAGGTTTGGACCCACCTTGAGG + Intronic
1060918891 9:127406741-127406763 TCAGCTTTGGCCCCACCCTGAGG - Intronic
1061794858 9:133080557-133080579 AGAGCTTAGATACCATCTTGAGG + Intronic
1187568755 X:20478965-20478987 AGAGCTTAGCTCCCACCTATAGG - Intergenic
1196374226 X:115014405-115014427 AGAGCTTTGTTTTAACCTTGTGG + Exonic
1196662739 X:118284750-118284772 AGAGCTCTGGTCCCATCATCAGG - Intergenic
1198653099 X:138885283-138885305 ATAGGATTGGTCTCACCTTGAGG + Intronic
1200071871 X:153533197-153533219 AGAGCTTAGGGCCCAGCTGGTGG + Intronic