ID: 1046556102

View in Genome Browser
Species Human (GRCh38)
Location 8:115775373-115775395
Sequence CACAAAGTGTACCAGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046556102_1046556105 -5 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556105 8:115775391-115775413 TTGTGCTTTGGTGCTCCCATGGG No data
1046556102_1046556104 -6 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556104 8:115775390-115775412 TTTGTGCTTTGGTGCTCCCATGG No data
1046556102_1046556108 8 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG No data
1046556102_1046556111 24 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556111 8:115775420-115775442 GTGAAGGTAGACTTTAGCTGAGG No data
1046556102_1046556107 2 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556107 8:115775398-115775420 TTGGTGCTCCCATGGGATCAGGG No data
1046556102_1046556106 1 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556106 8:115775397-115775419 TTTGGTGCTCCCATGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046556102 Original CRISPR CACAAAGTGTACCAGAGCTT TGG (reversed) Intronic
906960587 1:50417289-50417311 CACAGTGTGTACCCCAGCTTGGG - Intergenic
907457048 1:54582605-54582627 CAGAGAGAGGACCAGAGCTTAGG + Intronic
909904997 1:81183892-81183914 CACATAGTATTTCAGAGCTTGGG - Intergenic
913142980 1:115960214-115960236 GACAAAGTGTTTCAGAGCTGGGG + Intergenic
915604529 1:156942183-156942205 CACAGAGTGTAACAGAGGGTTGG - Intronic
916935056 1:169619117-169619139 CATAAAGTTTACCAGAGATCAGG + Exonic
917697672 1:177543500-177543522 TACAAAGTGTAGCTGAGGTTGGG - Intergenic
918060206 1:181054438-181054460 CCCAAAGTGGACCAGAAGTTTGG + Intronic
921109575 1:212021189-212021211 CACCAAGTTTGCCAGATCTTAGG + Exonic
921675669 1:217973556-217973578 CACTAAGAATACCAGAGATTTGG + Intergenic
921793792 1:219319572-219319594 CATAAAGGGTACTAGAGATTGGG - Intergenic
923420740 1:233812312-233812334 CAAGAAGTGTAGCAGTGCTTGGG - Intergenic
1065089663 10:22219261-22219283 CAATAAGAGTAACAGAGCTTCGG + Intergenic
1065226433 10:23548368-23548390 CACAGAGTGTATCAAAGCTAAGG + Intergenic
1067565779 10:47335818-47335840 CACAAAAGGTGCCAGAGGTTGGG - Intergenic
1077023138 11:428496-428518 CACATAGTGCACCAGAGCCCCGG + Exonic
1077230441 11:1456132-1456154 CGCTAAGTGGACCAAAGCTTTGG + Intronic
1080494729 11:32806003-32806025 CACAAAATGAACCACAGATTTGG - Intergenic
1084858166 11:72001886-72001908 CACAACCTTGACCAGAGCTTGGG + Exonic
1087078694 11:94149722-94149744 CACACAGTGGAGCAGAGCATGGG + Intronic
1089843033 11:121435278-121435300 CACAAAGGGAACCAAAGCTGTGG - Intergenic
1090115934 11:123973625-123973647 CACAAACTGTAGCACAGCTATGG - Intergenic
1090622761 11:128576039-128576061 CACAGAGTGCACCAGATGTTGGG - Intronic
1090729183 11:129555068-129555090 CACACAGAATGCCAGAGCTTTGG + Intergenic
1090967577 11:131612394-131612416 CACAAAATGTACTAGAACTGTGG + Intronic
1092146550 12:6218596-6218618 ATCAAAGTGTAACGGAGCTTAGG - Intronic
1092967293 12:13656885-13656907 CACAAAATGTCCCTGGGCTTCGG - Intronic
1093071910 12:14714688-14714710 CACCATGTGTGCCAGTGCTTTGG - Intergenic
1095870717 12:47024711-47024733 CATACACTGTAACAGAGCTTTGG - Intergenic
1102911608 12:116718982-116719004 GGCAAAGGGTACAAGAGCTTTGG + Intronic
1102960876 12:117092549-117092571 CACAAAGTGGTCCAGATCATGGG - Intronic
1103596664 12:122028354-122028376 CAGAAAGTGTGCCAGAGATCTGG - Intronic
1104734522 12:131128803-131128825 CACAAAGTGTTCCATAGAGTGGG + Intronic
1110261824 13:73493349-73493371 CACAAAGTGAGCCAGTTCTTGGG - Intergenic
1112322711 13:98421916-98421938 CACAAAATGTTCCAGATTTTAGG - Intronic
1115213482 14:30991639-30991661 CACTAACTTTACCAGAGTTTAGG + Intronic
1118363590 14:65076047-65076069 CACAAAGTCTATCAGAGGTGAGG + Exonic
1124418792 15:29498310-29498332 AACACAGTGTACCAAAACTTTGG - Intronic
1128991052 15:72260622-72260644 AACTAGGTGTACCAGAGCTTCGG - Exonic
1132100815 15:99021711-99021733 CACAGAGTGGACCAGAGAATGGG - Intergenic
1144085048 17:11800834-11800856 CACACAGTGTCCTAGAGGTTAGG - Intronic
1144647680 17:16986771-16986793 CACACAGAGTGCAAGAGCTTTGG + Intergenic
1147653078 17:42072891-42072913 CCCAAGGTGTCCCAGAGCTCAGG + Intergenic
1152165283 17:78700457-78700479 GACAGAGTGTTCCAGAACTTGGG + Intronic
1153913574 18:9725124-9725146 CAGCAAGTGTTCCAGAGCCTTGG + Intronic
1155457317 18:26031958-26031980 CACTAAGGTTACCAGAGGTTGGG + Intronic
1157889458 18:51401357-51401379 CACAAAGTGAAGAAGAGATTTGG + Intergenic
1158748117 18:60226229-60226251 CACAAAGTGAGCCAGTCCTTGGG + Intergenic
1162578625 19:11514099-11514121 CTCAAAGGGCACCAGAGCCTTGG + Exonic
1164147356 19:22520106-22520128 CAGAGAGTTAACCAGAGCTTGGG - Intronic
1164159242 19:22616004-22616026 CAGAGAGTTAACCAGAGCTTGGG + Intergenic
1168565893 19:57422971-57422993 CACAAACTGTAACACAGCCTCGG - Intronic
927577723 2:24213366-24213388 CAGGCAGTGTACCAGAGCTAGGG - Intronic
936574498 2:113641963-113641985 CACTAAATGTATCAGAGCTGCGG + Intronic
937668260 2:124511768-124511790 CACAAAGTGCACCAGAGTTTTGG - Intronic
938879878 2:135574442-135574464 CATAAATTGTTCCAGAGCATTGG + Intronic
939746729 2:145981211-145981233 CACAAATTGTACAATTGCTTTGG - Intergenic
943730953 2:191303093-191303115 CTCAAAATGTACCAGTGCTGTGG + Intronic
944313457 2:198261000-198261022 TACCATCTGTACCAGAGCTTGGG - Intronic
947152485 2:227129702-227129724 CAAAAAGTGTACCAGAGGCCAGG - Intronic
1169097687 20:2917514-2917536 CAAAAAGTGAACCAAAGCTAAGG - Intronic
1172625702 20:36345389-36345411 CACAGTGTGTACCAGACCCTGGG - Intronic
1173141463 20:40488497-40488519 AAAAAAGTGAACGAGAGCTTGGG + Intergenic
1173313469 20:41921528-41921550 AACCAAGTGAACCAGAGTTTGGG - Intergenic
1174958785 20:55131828-55131850 CTCAAAGTGTGCCATAGCTTGGG - Intergenic
1178599983 21:33986739-33986761 CTCAAAGTGTCCCTGAGTTTGGG + Intergenic
1178663798 21:34529217-34529239 CACAAATTGTACCAGAGCCCTGG + Intronic
1179835168 21:44026813-44026835 CAGAAAGTGTCCCACAGCTGGGG - Intronic
1181880418 22:25975018-25975040 CACAAGGTCTTCCAGAACTTTGG - Intronic
1183227757 22:36562054-36562076 CACAAAGTGAAGAAGGGCTTTGG + Intergenic
1183638800 22:39081052-39081074 CACAAAGTGTACAAGGGATATGG + Exonic
1183706562 22:39478205-39478227 CCCAAGGTGTACCAGGGCTGGGG + Intronic
1185425672 22:50768920-50768942 CACTAAATGTATCAGAGCTGCGG - Intronic
950331534 3:12159614-12159636 CACAAAGTGTCCCATCACTTAGG + Intronic
950610959 3:14126159-14126181 GACAAAGTGTACTAGGGCTGTGG - Intronic
952683647 3:36124320-36124342 CACACAGTGTACCTGGGCTTAGG - Intergenic
952989033 3:38815083-38815105 CACTAAGTGTGCTAGAGCTATGG + Intergenic
953463684 3:43101807-43101829 CTCAGATTGTCCCAGAGCTTAGG - Intronic
953546595 3:43868031-43868053 CACAAAGTCTTTCAGAGCTCTGG + Intergenic
954574627 3:51669106-51669128 CACAGAGTTAAACAGAGCTTTGG + Intronic
966853613 3:184179204-184179226 TTCAGAGTGTACCAGAGCCTCGG - Intronic
967380620 3:188853520-188853542 CACAAAGTGTTTAAAAGCTTGGG + Intronic
969030844 4:4212291-4212313 CACCAAGTTTACCAGTGCTGTGG + Intronic
972434498 4:39019467-39019489 CACAAAATGTGGCAGAGCATTGG + Intronic
972642164 4:40934795-40934817 CAGAGAGTGTACGTGAGCTTAGG + Intronic
974656827 4:64835612-64835634 CACAAGGTGCACAAGAGATTAGG + Intergenic
975967788 4:79995910-79995932 CAGAAACTGAACCAGAGCTAAGG + Intronic
976486217 4:85607995-85608017 CACAAAATGTGCCAGAGGTAGGG + Intronic
978410367 4:108418459-108418481 CACAAAGTCCTCCAGTGCTTTGG + Intergenic
978709141 4:111756194-111756216 CACAGTGTGTACCAGAACTATGG - Intergenic
986427514 5:7649596-7649618 GCCAGAGTGTACCAGGGCTTAGG + Intronic
986576087 5:9214286-9214308 CACAAAGGCTTCCAGAGCTCGGG + Intronic
986891565 5:12314836-12314858 CAAAAAGAGTATCAGAGCTAAGG + Intergenic
989084709 5:37663678-37663700 CACAAAGTCTACCAGAAGTCCGG - Intronic
989503909 5:42203160-42203182 CAAAAATTGTAGCAGAGCTGTGG + Intergenic
991776959 5:70094853-70094875 CACAGAGTGTATCAAAGCTCAGG - Intergenic
991856245 5:70970298-70970320 CACAGAGTGTATCAAAGCTCAGG - Exonic
992385201 5:76278152-76278174 CACAATGTGTACATGAGCATGGG - Intronic
994958477 5:106565666-106565688 CACAAATTGTACTAGAGCTAAGG - Intergenic
995067570 5:107879616-107879638 CACAAAGGACACAAGAGCTTTGG + Intronic
999061575 5:148641241-148641263 CACAACTTGTACCTGAGCATAGG - Intronic
1000141736 5:158411480-158411502 CAAACAATCTACCAGAGCTTGGG - Intergenic
1000529127 5:162396834-162396856 AACAAAGTATACCAAAGCTATGG + Intergenic
1001123057 5:168995926-168995948 CAGAAAGAATACCAGTGCTTTGG - Intronic
1002008915 5:176260853-176260875 CACTAGGTGTACCAGAGCCTGGG - Intronic
1002217809 5:177651419-177651441 CACTAGGTGTACCAGAGCCTGGG + Intergenic
1002796260 6:473491-473513 CACGAAGTGGACCAGGGCTGAGG - Intergenic
1005455646 6:26017417-26017439 GACAAAGGGTACCGGAGCCTCGG - Exonic
1008265809 6:49424792-49424814 CAGGAAGTGAAGCAGAGCTTTGG - Intergenic
1009742918 6:67770703-67770725 TACAATGTTTACCAGAGGTTAGG - Intergenic
1011818106 6:91216205-91216227 CACAAAGTATACCACAGACTAGG - Intergenic
1014062485 6:117088787-117088809 CACAAATGGTGCCAGAGCTCTGG + Intergenic
1015781654 6:136874155-136874177 TACAAGTTGTTCCAGAGCTTTGG - Intronic
1018730320 6:166645438-166645460 AACAGGGTGTACCAGTGCTTAGG - Intronic
1019181833 6:170192278-170192300 CACAATGTGAACCAGTGCATGGG + Intergenic
1020582489 7:10021620-10021642 CACCAAGGGTAACAGTGCTTGGG - Intergenic
1022519679 7:30998173-30998195 CACACAGAGAATCAGAGCTTGGG + Intergenic
1027473528 7:78602082-78602104 GAGAAATTGTTCCAGAGCTTGGG - Intronic
1034030551 7:147758408-147758430 CAGAAACTAAACCAGAGCTTAGG - Intronic
1042408378 8:68432842-68432864 CAAAACTTGTAACAGAGCTTAGG + Intronic
1046556102 8:115775373-115775395 CACAAAGTGTACCAGAGCTTTGG - Intronic
1047858227 8:128936030-128936052 AACAAAGTGAGTCAGAGCTTGGG + Intergenic
1049853521 8:144847597-144847619 CACAAAGTGAAGCAGAGCAAGGG + Intronic
1051729648 9:20127157-20127179 CAGAAAGGGAACCAGAGCATTGG - Intergenic
1055389106 9:75799827-75799849 CACAAAGTGTACCACCACATAGG + Intergenic
1056209004 9:84347656-84347678 CAAAAAGTGTGCCAGTGCTTAGG + Intergenic
1058782105 9:108348261-108348283 CACAAACTGTGCAAGAGCTTGGG - Intergenic
1059195992 9:112371550-112371572 CACACATTGTTCAAGAGCTTTGG + Intergenic
1060451422 9:123744626-123744648 GACAAAGTGTACATGAGCCTAGG - Intronic
1062658610 9:137616735-137616757 CAGAAAGTGTACCACAGGTGGGG + Intronic
1187323554 X:18265024-18265046 CACAAAGTGTACTTGACCTAAGG + Intronic
1189311059 X:40017913-40017935 TATAAAGTGTATCAGAGATTTGG + Intergenic
1197058383 X:122147931-122147953 CACATAGAGTACAAGAGCTGTGG + Intergenic
1197067653 X:122253019-122253041 CAGAAACTGTACCATAGCATTGG + Intergenic
1197158145 X:123292679-123292701 AACAAAGTGTTACTGAGCTTAGG - Intronic
1197584028 X:128322025-128322047 CACATAGGGTATTAGAGCTTTGG - Intergenic
1198495920 X:137193291-137193313 CATAAACTGTACCAGAGCATAGG + Intergenic
1199603846 X:149560818-149560840 CTCAGAGTGTACCATAGTTTGGG - Intergenic
1199639568 X:149847272-149847294 CACCAAGTGTACCATGGTTTGGG + Intergenic
1199646543 X:149918656-149918678 CTCAGAGTGTACCATAGTTTGGG + Intergenic
1199714087 X:150493646-150493668 CACAAAGCTTGCCAGAGCCTAGG - Intronic
1202092038 Y:21201683-21201705 CACACAATGTACCAGATCTCTGG - Intergenic