ID: 1046556108

View in Genome Browser
Species Human (GRCh38)
Location 8:115775404-115775426
Sequence CTCCCATGGGATCAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046556100_1046556108 21 Left 1046556100 8:115775360-115775382 CCTCAAGGTGGGACCAAAGCTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG No data
1046556099_1046556108 26 Left 1046556099 8:115775355-115775377 CCTTGCCTCAAGGTGGGACCAAA 0: 1
1: 1
2: 10
3: 37
4: 197
Right 1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG No data
1046556102_1046556108 8 Left 1046556102 8:115775373-115775395 CCAAAGCTCTGGTACACTTTGTG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046556108 Original CRISPR CTCCCATGGGATCAGGGTGA AGG Intronic
No off target data available for this crispr