ID: 1046564097

View in Genome Browser
Species Human (GRCh38)
Location 8:115876492-115876514
Sequence CTTGGAAGAAGCAGAGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046564097_1046564099 -4 Left 1046564097 8:115876492-115876514 CCAACAACTCTGCTTCTTCCAAG No data
Right 1046564099 8:115876511-115876533 CAAGAAGATAACTGAATTATTGG No data
1046564097_1046564100 8 Left 1046564097 8:115876492-115876514 CCAACAACTCTGCTTCTTCCAAG No data
Right 1046564100 8:115876523-115876545 TGAATTATTGGCAGTTCTTCTGG No data
1046564097_1046564101 26 Left 1046564097 8:115876492-115876514 CCAACAACTCTGCTTCTTCCAAG No data
Right 1046564101 8:115876541-115876563 TCTGGAAAATAACCCCACATTGG No data
1046564097_1046564102 30 Left 1046564097 8:115876492-115876514 CCAACAACTCTGCTTCTTCCAAG No data
Right 1046564102 8:115876545-115876567 GAAAATAACCCCACATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046564097 Original CRISPR CTTGGAAGAAGCAGAGTTGT TGG (reversed) Intergenic
No off target data available for this crispr