ID: 1046566090

View in Genome Browser
Species Human (GRCh38)
Location 8:115903420-115903442
Sequence CACCTTGTAAGAGGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046566090_1046566096 7 Left 1046566090 8:115903420-115903442 CCATATTCCCCTCTTACAAGGTG No data
Right 1046566096 8:115903450-115903472 CAATCTTCCCATCAAGAGGTGGG No data
1046566090_1046566095 6 Left 1046566090 8:115903420-115903442 CCATATTCCCCTCTTACAAGGTG No data
Right 1046566095 8:115903449-115903471 ACAATCTTCCCATCAAGAGGTGG No data
1046566090_1046566094 3 Left 1046566090 8:115903420-115903442 CCATATTCCCCTCTTACAAGGTG No data
Right 1046566094 8:115903446-115903468 TTGACAATCTTCCCATCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046566090 Original CRISPR CACCTTGTAAGAGGGGAATA TGG (reversed) Intergenic
No off target data available for this crispr