ID: 1046568564

View in Genome Browser
Species Human (GRCh38)
Location 8:115933047-115933069
Sequence TTTCATGTGCAGAAAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046568561_1046568564 3 Left 1046568561 8:115933021-115933043 CCTGGTTCTTCTTTTCTTTCTCT No data
Right 1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046568564 Original CRISPR TTTCATGTGCAGAAAGTGGT AGG Intergenic
No off target data available for this crispr