ID: 1046569333

View in Genome Browser
Species Human (GRCh38)
Location 8:115943128-115943150
Sequence CTCAATAGTCAAGTGTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046569333_1046569337 -2 Left 1046569333 8:115943128-115943150 CCATACCACACTTGACTATTGAG No data
Right 1046569337 8:115943149-115943171 AGATTTATGGGATATTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046569333 Original CRISPR CTCAATAGTCAAGTGTGGTA TGG (reversed) Intergenic
No off target data available for this crispr