ID: 1046578655

View in Genome Browser
Species Human (GRCh38)
Location 8:116064364-116064386
Sequence TTGTTTGGAGTAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046578651_1046578655 -8 Left 1046578651 8:116064349-116064371 CCAGTGGTGCACAATTTGTTTGG No data
Right 1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG No data
1046578649_1046578655 1 Left 1046578649 8:116064340-116064362 CCATTACCACCAGTGGTGCACAA No data
Right 1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG No data
1046578650_1046578655 -5 Left 1046578650 8:116064346-116064368 CCACCAGTGGTGCACAATTTGTT No data
Right 1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG No data
1046578647_1046578655 17 Left 1046578647 8:116064324-116064346 CCATAAAAAAAAATCACCATTAC No data
Right 1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046578655 Original CRISPR TTGTTTGGAGTAAGGGAAGA AGG Intergenic
No off target data available for this crispr