ID: 1046579913

View in Genome Browser
Species Human (GRCh38)
Location 8:116079256-116079278
Sequence GAAGTGGCCTCCCTCTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046579913_1046579916 -1 Left 1046579913 8:116079256-116079278 CCACCTAAGAGGGAGGCCACTTC No data
Right 1046579916 8:116079278-116079300 CTAAAATATTTAGAATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046579913 Original CRISPR GAAGTGGCCTCCCTCTTAGG TGG (reversed) Intergenic
No off target data available for this crispr