ID: 1046579916

View in Genome Browser
Species Human (GRCh38)
Location 8:116079278-116079300
Sequence CTAAAATATTTAGAATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046579914_1046579916 -4 Left 1046579914 8:116079259-116079281 CCTAAGAGGGAGGCCACTTCTAA No data
Right 1046579916 8:116079278-116079300 CTAAAATATTTAGAATTTTCAGG No data
1046579909_1046579916 19 Left 1046579909 8:116079236-116079258 CCTGTTCAAATCAGTGGATACCA No data
Right 1046579916 8:116079278-116079300 CTAAAATATTTAGAATTTTCAGG No data
1046579913_1046579916 -1 Left 1046579913 8:116079256-116079278 CCACCTAAGAGGGAGGCCACTTC No data
Right 1046579916 8:116079278-116079300 CTAAAATATTTAGAATTTTCAGG No data
1046579907_1046579916 28 Left 1046579907 8:116079227-116079249 CCAAAAAAGCCTGTTCAAATCAG No data
Right 1046579916 8:116079278-116079300 CTAAAATATTTAGAATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046579916 Original CRISPR CTAAAATATTTAGAATTTTC AGG Intergenic
No off target data available for this crispr