ID: 1046582542

View in Genome Browser
Species Human (GRCh38)
Location 8:116110985-116111007
Sequence CCTCTTGGTACCTGGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046582542_1046582549 20 Left 1046582542 8:116110985-116111007 CCAAGGACCCAGGTACCAAGAGG No data
Right 1046582549 8:116111028-116111050 ACCCTGACTCTCCACTGAGCTGG No data
1046582542_1046582548 -8 Left 1046582542 8:116110985-116111007 CCAAGGACCCAGGTACCAAGAGG No data
Right 1046582548 8:116111000-116111022 CCAAGAGGGCAGAGTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046582542 Original CRISPR CCTCTTGGTACCTGGGTCCT TGG (reversed) Intergenic