ID: 1046584350

View in Genome Browser
Species Human (GRCh38)
Location 8:116133149-116133171
Sequence GAGGGGCCATAGGCTCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046584345_1046584350 -5 Left 1046584345 8:116133131-116133153 CCTGTCCAAGCTCAAAGGGAGGG No data
Right 1046584350 8:116133149-116133171 GAGGGGCCATAGGCTCATCTTGG No data
1046584348_1046584350 -10 Left 1046584348 8:116133136-116133158 CCAAGCTCAAAGGGAGGGGCCAT No data
Right 1046584350 8:116133149-116133171 GAGGGGCCATAGGCTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046584350 Original CRISPR GAGGGGCCATAGGCTCATCT TGG Intergenic
No off target data available for this crispr