ID: 1046585782

View in Genome Browser
Species Human (GRCh38)
Location 8:116147701-116147723
Sequence GGCCTGTTACTGGGTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046585782_1046585789 26 Left 1046585782 8:116147701-116147723 CCACCAAAACCCAGTAACAGGCC No data
Right 1046585789 8:116147750-116147772 GTTATTTGCAGAAGATGGCAGGG No data
1046585782_1046585787 21 Left 1046585782 8:116147701-116147723 CCACCAAAACCCAGTAACAGGCC No data
Right 1046585787 8:116147745-116147767 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322
1046585782_1046585788 25 Left 1046585782 8:116147701-116147723 CCACCAAAACCCAGTAACAGGCC No data
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046585782 Original CRISPR GGCCTGTTACTGGGTTTTGG TGG (reversed) Intergenic
No off target data available for this crispr