ID: 1046585783

View in Genome Browser
Species Human (GRCh38)
Location 8:116147704-116147726
Sequence CTTGGCCTGTTACTGGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046585783_1046585789 23 Left 1046585783 8:116147704-116147726 CCAAAACCCAGTAACAGGCCAAG No data
Right 1046585789 8:116147750-116147772 GTTATTTGCAGAAGATGGCAGGG No data
1046585783_1046585788 22 Left 1046585783 8:116147704-116147726 CCAAAACCCAGTAACAGGCCAAG No data
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data
1046585783_1046585787 18 Left 1046585783 8:116147704-116147726 CCAAAACCCAGTAACAGGCCAAG No data
Right 1046585787 8:116147745-116147767 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046585783 Original CRISPR CTTGGCCTGTTACTGGGTTT TGG (reversed) Intergenic
No off target data available for this crispr