ID: 1046585786

View in Genome Browser
Species Human (GRCh38)
Location 8:116147722-116147744
Sequence TTTTTTTAAGAGACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1347
Summary {0: 2, 1: 7, 2: 55, 3: 316, 4: 967}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046585786_1046585790 27 Left 1046585786 8:116147722-116147744 CCAAGAGCTGTCTCTTAAAAAAA 0: 2
1: 7
2: 55
3: 316
4: 967
Right 1046585790 8:116147772-116147794 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240
1046585786_1046585788 4 Left 1046585786 8:116147722-116147744 CCAAGAGCTGTCTCTTAAAAAAA 0: 2
1: 7
2: 55
3: 316
4: 967
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data
1046585786_1046585789 5 Left 1046585786 8:116147722-116147744 CCAAGAGCTGTCTCTTAAAAAAA 0: 2
1: 7
2: 55
3: 316
4: 967
Right 1046585789 8:116147750-116147772 GTTATTTGCAGAAGATGGCAGGG No data
1046585786_1046585787 0 Left 1046585786 8:116147722-116147744 CCAAGAGCTGTCTCTTAAAAAAA 0: 2
1: 7
2: 55
3: 316
4: 967
Right 1046585787 8:116147745-116147767 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046585786 Original CRISPR TTTTTTTAAGAGACAGCTCT TGG (reversed) Intergenic
901276791 1:7997876-7997898 TCTTTTTAATAATCAGCTCTTGG - Intergenic
901295093 1:8155234-8155256 TTTTTTTAAAGGAAAGCTGTAGG + Intergenic
901444628 1:9300549-9300571 TCCTTTTGAGAGACAGCTCTTGG + Intronic
901904050 1:12392659-12392681 TCCTTTTGAGAGACAGCTCTTGG - Intronic
902115684 1:14119088-14119110 TCTTTTTCAGAGACAACACTAGG + Intergenic
902840536 1:19071275-19071297 TGTTTTTAAGTGACTGCTCTGGG + Intergenic
903045319 1:20560226-20560248 TTCTCCTAACAGACAGCTCTAGG + Intergenic
903130291 1:21274819-21274841 TTTTTTTATGGCACACCTCTCGG - Intronic
903445833 1:23422711-23422733 TCTTTTCAGGGGACAGCTCTGGG + Intronic
904179492 1:28655946-28655968 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
904335933 1:29798011-29798033 TCCTCTTGAGAGACAGCTCTTGG + Intergenic
904510227 1:30999293-30999315 TTTTTTTAAAAGACTGGGCTAGG - Intronic
904993501 1:34613029-34613051 TTTATTTAAGAGCTATCTCTAGG + Intergenic
905144437 1:35876792-35876814 GTTTTTTAAGAGACAGGCTTTGG + Intronic
905444943 1:38021415-38021437 TTTTATTAAGAGACTGCTGGTGG + Intronic
905695637 1:39971587-39971609 TTTTTTTTAAAGACAGGACTTGG - Intergenic
905725733 1:40250340-40250362 TTTTTTTAAGAGACAGGGTCTGG + Intronic
905963954 1:42073466-42073488 TTTTTTAAAAAGACAGCTTTTGG + Intergenic
906050490 1:42867439-42867461 TTCTTTGGAGAGACAGCTCTTGG + Intergenic
906368376 1:45231013-45231035 TTTTAAGAAGAGACAACTCTTGG + Intronic
906476534 1:46172979-46173001 TTTTTTTTTGAGACAGCGCCTGG - Intronic
906597739 1:47094399-47094421 TTTTTTAAAAAGACAGCTAGTGG + Intronic
906683540 1:47747834-47747856 TTTTTTTGAGAGCTGGCTCTGGG + Intergenic
906973618 1:50545568-50545590 TTTTTTTAAAATATAGCTTTAGG - Intronic
906992328 1:50752552-50752574 TCTTTTTAAAAAACAGCTTTAGG + Intronic
907295666 1:53451081-53451103 TTATTTTAAGAGACAGTTTAAGG - Intergenic
907780342 1:57560859-57560881 TCCTTTTGAGAGTCAGCTCTTGG + Intronic
908002007 1:59689512-59689534 TTTTTTTAAAAGACAGTTAAAGG - Intronic
908015827 1:59834784-59834806 TTTTTTAAAGAGCCAACTTTTGG + Intronic
908198268 1:61767525-61767547 ATTTTTTAAGAGACAGGTCTTGG - Intronic
908526640 1:64994116-64994138 TTTTTTGTAGAGACAGGTTTTGG + Intergenic
908668990 1:66524776-66524798 TTCTTTTGAGAAACAGCTTTCGG + Intergenic
908803956 1:67910306-67910328 TTTTTTAAAGAGACTACGCTGGG - Intergenic
909093346 1:71255045-71255067 CTTTTTCAAGATACAGCTTTAGG - Intergenic
909211802 1:72833683-72833705 TTTTTTCAAAAAACAGCTCCTGG - Intergenic
909278734 1:73722148-73722170 TCCTTTTGAGAGTCAGCTCTTGG + Intergenic
909576921 1:77185883-77185905 TCCTTTTGAGAGACAGCTCTTGG + Intronic
909715049 1:78697955-78697977 TCTTTCAAAGAGACAGCTCCTGG + Intergenic
909810955 1:79931362-79931384 TCTTCTTTTGAGACAGCTCTTGG + Intergenic
910058045 1:83055434-83055456 TTTTTTTAGGAGACAGTTGCAGG - Intergenic
910069650 1:83196380-83196402 TAATTTTCAGAGACATCTCTAGG + Intergenic
910141289 1:84030014-84030036 TACTTTTGAGAAACAGCTCTTGG + Intergenic
910149372 1:84124052-84124074 CTTTTTTATGAGATAGCTTTAGG - Intronic
910226913 1:84945033-84945055 GTTTCTTAAGACACAGCTCTAGG + Intronic
910245320 1:85132628-85132650 TTTTTTTGAGAGACAGTGGTTGG + Intronic
910286468 1:85560634-85560656 TTTTTTTAATTGATTGCTCTGGG - Intronic
910370635 1:86512153-86512175 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
910561902 1:88600006-88600028 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
910638990 1:89439949-89439971 TCCTTTTGAGAGACAACTCTTGG - Intergenic
910790322 1:91043745-91043767 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
910831097 1:91463399-91463421 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
910907432 1:92195435-92195457 TTGTTTTAAGAATCAGCTCTTGG - Intergenic
910948215 1:92616713-92616735 TCCTTTTGAGAGACAGCTGTTGG + Intronic
911130484 1:94382586-94382608 ATTTTTTAAGTGACAGGTATAGG - Intergenic
911245858 1:95516420-95516442 TTTTTTTAATTTACTGCTCTGGG - Intergenic
911257324 1:95647339-95647361 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
911588524 1:99719057-99719079 TTTTTTTTTGACACAGCTGTTGG - Intronic
911642332 1:100302577-100302599 TTCTTTTCAGAAACAGATCTTGG + Intergenic
911738397 1:101361894-101361916 TCCTTTTGAGACACAGCTCTTGG - Intergenic
911800487 1:102131825-102131847 TTTTTCAAAGAAACAGCTCCTGG - Intergenic
911883574 1:103270474-103270496 CCCTTTTGAGAGACAGCTCTTGG + Intergenic
911980427 1:104559446-104559468 TCCTTTTGAGAGACAACTCTTGG + Intergenic
911981898 1:104579237-104579259 TCTTTTTGAGAGAAAACTCTTGG - Intergenic
912045319 1:105446627-105446649 TTTTTCAAAAACACAGCTCTTGG + Intergenic
912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG + Intergenic
912129911 1:106588025-106588047 TCCTTTTAAGAGACAACTCTTGG - Intergenic
912212253 1:107568919-107568941 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
912252029 1:108021363-108021385 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
912308969 1:108599812-108599834 TGTTTTTAAGAGACAGGGTTTGG - Intronic
912464320 1:109860170-109860192 TTTTTCAAAAAAACAGCTCTTGG - Intergenic
912608870 1:111022210-111022232 TTTTTTCAAGACCCAGCTGTTGG - Intergenic
912733322 1:112128804-112128826 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
913280244 1:117178603-117178625 TTTTTTTTAGAGACAGGGCCCGG + Intronic
914666470 1:149837057-149837079 AGTTTTTAAAAGATAGCTCTTGG + Intergenic
914669297 1:149856741-149856763 AGTTTTTAAAAGATAGCTCTTGG - Intronic
914972607 1:152324216-152324238 TGTTTTTAAAAGACCACTCTGGG - Intronic
914999320 1:152573621-152573643 TTTTTCTAAGAGAAGGATCTGGG + Intronic
915329269 1:155099744-155099766 TTTTTTTTAGAGACAGAGTTGGG - Intergenic
915667670 1:157459618-157459640 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
915789412 1:158651853-158651875 ATATTGTAAGAAACAGCTCTAGG + Intronic
915946535 1:160156435-160156457 TTTTTTAAAGAGACAAGTGTTGG + Intronic
916106329 1:161435302-161435324 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
916285317 1:163099553-163099575 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
916365967 1:164028062-164028084 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
916752024 1:167731736-167731758 TTTTTTTGAGACACAGTTTTAGG - Intronic
917151207 1:171946851-171946873 TCTTTTTAACAACCAGCTCTTGG + Intronic
917217213 1:172690888-172690910 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
917462708 1:175246208-175246230 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
917524933 1:175780234-175780256 TTTTTTTAAAAAAGAGCCCTGGG + Intergenic
918135235 1:181667511-181667533 TTTTCTTAAGACACAGATATTGG - Intronic
918815079 1:189171253-189171275 TCTTTTTGAGAACCAGCTCTTGG + Intergenic
918907449 1:190515168-190515190 TTTTTTTAACAACCAGCTCTTGG - Intergenic
918918231 1:190671854-190671876 TCCTTCTGAGAGACAGCTCTTGG - Intergenic
918958246 1:191237974-191237996 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
919031255 1:192245829-192245851 TTTTTCTAAAAAACAGCTCCCGG + Intergenic
919241773 1:194924229-194924251 TCCTTTTGAGAGACAGCTATTGG + Intergenic
919489760 1:198192337-198192359 TTTTTTAAAGAACCAGCTTTTGG + Intronic
919494506 1:198247720-198247742 TTTTTTTAAGAGAAAACATTGGG + Intronic
919695034 1:200566290-200566312 TTTTTTTAAGAGACAGGGTTGGG + Intronic
920417350 1:205807665-205807687 TTTTTTTTTGAGACAGCGTTTGG + Intronic
920495359 1:206450932-206450954 TTTTTTTAAGAGACAGGGTCTGG - Intronic
920609962 1:207426361-207426383 TTTTTTTTAGAGACAGGTTTTGG - Intergenic
920679992 1:208064911-208064933 TGCTTTTAAGAGAGAGCCCTGGG - Intronic
920898514 1:210082778-210082800 CTGTTTTGAGAAACAGCTCTTGG - Intronic
921022670 1:211250471-211250493 TTTTTTTTTGAGACTGATCTTGG - Intergenic
921452195 1:215322511-215322533 TTTTGTAAAGAGGCTGCTCTAGG - Intergenic
921502315 1:215920364-215920386 TTAGTTTTAGAGACAGCTGTTGG + Intronic
921619820 1:217313162-217313184 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
922041054 1:221898039-221898061 TTTTTCTAAGATCCAGCTTTTGG - Intergenic
922178863 1:223217960-223217982 TATTTTTAACAACCAGCTCTTGG - Intergenic
922781047 1:228252556-228252578 TCATTTTGAGAGACAGCTCTTGG - Intronic
923001121 1:230007208-230007230 TTTTATGAGGAGACAGCTCCAGG - Intergenic
923253569 1:232199412-232199434 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
923574156 1:235142626-235142648 AATCTTTAAGAGACACCTCTGGG + Intronic
924153770 1:241154918-241154940 TTTTTTTAAAAAATGGCTCTTGG - Intronic
924182507 1:241453216-241453238 TTTTCTTGAGAGACAGTTCTTGG - Intergenic
924367769 1:243314002-243314024 ATTTTTTTAGAAAGAGCTCTGGG - Intronic
924416793 1:243864462-243864484 TTTTTTTTAGAGACAGCGTCTGG + Intergenic
924477398 1:244394176-244394198 TCCTTTTGAGAGACAACTCTTGG - Intergenic
924840776 1:247707807-247707829 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
924847133 1:247785113-247785135 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1063305512 10:4895898-4895920 TTGTTTTAAGAAACATCTATTGG + Intergenic
1064519446 10:16186049-16186071 TACTTTCAAGAGACAGCTCTTGG - Intergenic
1064545688 10:16448110-16448132 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1065005327 10:21374189-21374211 TCATTTTTAGAGACAGCTCTTGG + Intergenic
1065148182 10:22794184-22794206 TTTTTTTCAGTGAAAACTCTAGG + Intergenic
1065328167 10:24568741-24568763 TTTTTTTTTGAGACAAATCTTGG - Intergenic
1065500014 10:26371115-26371137 TGTTTTAAAGAGCCAACTCTTGG + Intergenic
1065653296 10:27916881-27916903 GTTGTTCAAGGGACAGCTCTAGG + Intronic
1065782530 10:29183510-29183532 TTTATTTGAGAGAGTGCTCTAGG + Intergenic
1066115467 10:32235382-32235404 TTTTTTTAAGTGGTTGCTCTAGG + Intergenic
1066167027 10:32799205-32799227 TCCTTTTGAGAGTCAGCTCTTGG - Intronic
1067019437 10:42782189-42782211 TTTTTTTAAGAGAGAGAGGTAGG + Intergenic
1067333140 10:45340242-45340264 TGCTTTTGAAAGACAGCTCTTGG + Intergenic
1067518967 10:46980510-46980532 TCTTTTTGAGAAACAGCTTTTGG + Intronic
1067643279 10:48071324-48071346 TCTTTTTGAGAAACAGCTTTTGG - Intergenic
1067754348 10:48993694-48993716 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1068007673 10:51409545-51409567 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1068147924 10:53095047-53095069 TTTTTTTCCTAGACAGCTTTTGG + Intergenic
1068447210 10:57138618-57138640 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1068837216 10:61568353-61568375 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1068908867 10:62357309-62357331 TCCTGTTGAGAGACAGCTCTTGG + Intergenic
1069003341 10:63291003-63291025 TCTTTTTAAGAAACAGGGCTTGG + Intronic
1069145763 10:64890465-64890487 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1069186126 10:65425717-65425739 TTCTTTAAAGAAACAGCTTTTGG - Intergenic
1069192305 10:65506345-65506367 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
1069208594 10:65726140-65726162 GTTTTTTAAGAGGCAGCTTCTGG - Intergenic
1069509725 10:69033022-69033044 TTTTTTTAGGAGATGGATCTTGG - Intergenic
1069520942 10:69120710-69120732 TTTTTTTAAGAGTCAGGGCCTGG + Intergenic
1069561460 10:69433449-69433471 TGTTTTTAAGTGAGAACTCTTGG - Intergenic
1069787668 10:70998946-70998968 CTTTTTTAACAACCAGCTCTCGG - Intergenic
1069790831 10:71019558-71019580 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
1070455116 10:76605798-76605820 TTTTTTCTTGAGACACCTCTAGG + Intergenic
1071029746 10:81163033-81163055 TTATTTTAAGAAACAGTGCTGGG - Intergenic
1071163082 10:82774704-82774726 TTTTTCAAAGAAACAACTCTTGG + Intronic
1071256404 10:83875735-83875757 TTTATTTAAGACCCAGCTCTTGG - Intergenic
1071267086 10:83973977-83973999 TCCTTTTAAGAGACAGCCCTTGG - Intergenic
1071364468 10:84884496-84884518 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1071378384 10:85033382-85033404 TCCTTTTGAGAGATAGCTCTTGG + Intergenic
1071673927 10:87637404-87637426 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
1071937689 10:90549301-90549323 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1071947086 10:90657706-90657728 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
1072001728 10:91201733-91201755 TTTTTTTAAGAAACCCATCTTGG + Intronic
1072209258 10:93231653-93231675 TCCTTTTGAGAGACAGATCTTGG - Intergenic
1072293289 10:93986325-93986347 TTTTTTGAAGAACCAGCTCTTGG + Intergenic
1072360469 10:94654168-94654190 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1072592153 10:96836297-96836319 TTTTTTTTAGAGACAGGGTTTGG + Intronic
1073398478 10:103237874-103237896 TTTTTTTTAGAGACAGGGCCTGG - Intergenic
1073557349 10:104465925-104465947 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1073787396 10:106905201-106905223 TTTTCCTAAGAAACAACTCTTGG - Intronic
1073830504 10:107377984-107378006 TCTTTTTGAGAGACAGTTCTTGG - Intergenic
1073918476 10:108432290-108432312 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1073957682 10:108891628-108891650 CCCTTTTGAGAGACAGCTCTTGG - Intergenic
1073995873 10:109314692-109314714 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
1074142538 10:110686611-110686633 TTTTTTTTAGAGACAGCATCTGG - Intronic
1074268111 10:111925963-111925985 TTTTTTTAAAAAAAACCTCTAGG + Intergenic
1074892301 10:117745832-117745854 TTATTTTCAGAGAGAGGTCTTGG - Intergenic
1075143795 10:119866076-119866098 TTTTTTTAAGAGATAGAGCCTGG - Intronic
1075431552 10:122387106-122387128 TCTTTTCAAGAAACAGCTTTTGG + Intronic
1075606789 10:123817424-123817446 TCCTTTTGAGAGACAGCACTTGG + Intronic
1076123291 10:127953370-127953392 TCCTTTTGAGAGACAACTCTTGG + Intronic
1076772629 10:132674814-132674836 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1077658851 11:4048118-4048140 TTCTTTGAAGACACAGGTCTTGG - Intronic
1077812336 11:5650821-5650843 CTTTTTCAAGAAACAGCTTTTGG - Intergenic
1079936444 11:26622415-26622437 TTTTTTTCAGAGATGGCTTTTGG - Intronic
1080020139 11:27551641-27551663 TTCTTTTGAGAGACAGCTCTGGG - Intergenic
1080039602 11:27745354-27745376 TATTTTTCAGAGATAGATCTTGG - Intergenic
1080076593 11:28157520-28157542 CCCTTTTGAGAGACAGCTCTTGG + Intronic
1080347726 11:31343605-31343627 TTTTTTTAAGAGACAGGGTCAGG - Intronic
1080381878 11:31780181-31780203 TTTTTTCAGAAGACAGATCTGGG + Intronic
1080430687 11:32196000-32196022 TTTTTATAACACACAGCTCCAGG + Intergenic
1080821302 11:35809198-35809220 ATTATCTAAGAGACAGCTCAGGG - Exonic
1080976680 11:37350597-37350619 TCCTTTTGAGAGACAGCTTTTGG + Intergenic
1081065460 11:38534877-38534899 TCTTTTTGAGAGGCAGCTCTTGG - Intergenic
1081110477 11:39128418-39128440 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1081117429 11:39221010-39221032 TTTTTTTAAGATTCAGCTTTTGG - Intergenic
1081236051 11:40648350-40648372 TTTTTTTTAGTGTGAGCTCTAGG - Intronic
1081269728 11:41068433-41068455 TTTTTTCAAAAAACAGCTCCTGG - Intronic
1081349302 11:42029473-42029495 TCTTTTTAAGAACCAGCTGTTGG - Intergenic
1081609061 11:44547877-44547899 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1082585854 11:54938885-54938907 GTTTTCTAAGAAACTGCTCTGGG - Intergenic
1083210913 11:61185378-61185400 TTTTTTTAAAAGACAGCTTTTGG + Intergenic
1083391631 11:62355522-62355544 TTTTTTCAAGAGAGAAATCTTGG - Intronic
1083522099 11:63323636-63323658 TTTTTCAAAGAACCAGCTCTGGG - Intronic
1083575734 11:63789899-63789921 TTTTTCAAAGAGCCAGCTTTTGG - Intergenic
1083965295 11:66040057-66040079 TCTTTTTAACAACCAGCTCTTGG - Intergenic
1083979640 11:66156543-66156565 TTTTTTTAAAAAACAACTTTAGG - Intronic
1084202971 11:67574428-67574450 TTTTTTTAAGAGACAGAGTCTGG + Intergenic
1085435472 11:76495905-76495927 ATCTGTTAAGAGACAGGTCTGGG + Intronic
1085684621 11:78610416-78610438 TTCTTTTGAGTAACAGCTCTTGG + Intergenic
1085685962 11:78622189-78622211 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1085747570 11:79128239-79128261 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1086183930 11:83990722-83990744 CTTTCTTAGGAGAGAGCTCTGGG + Intronic
1086278612 11:85160451-85160473 TCCTTTTGAGAAACAGCTCTTGG + Intronic
1086428337 11:86710107-86710129 TTTTTTTAAATGACTGCTCTAGG - Intergenic
1086603287 11:88662384-88662406 TTTATTTAAGAGACATGTATTGG + Intronic
1086834115 11:91600392-91600414 TCCTTTTGGGAGACAGCTCTTGG + Intergenic
1087021604 11:93608728-93608750 TCTTTTTGAGAAATAGCTCTTGG - Intergenic
1087343952 11:96945543-96945565 TTTTTTTTAGTGATTGCTCTAGG - Intergenic
1087358592 11:97127571-97127593 CTTTTTAAAGAACCAGCTCTTGG + Intergenic
1087374021 11:97320553-97320575 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1087470053 11:98561648-98561670 ATTTATTAAAAGAAAGCTCTCGG - Intergenic
1087562823 11:99813331-99813353 TTTCTTTAAGTGACAGCTCTTGG + Intronic
1087749065 11:101986006-101986028 TTTTTTTGAGACAGAGCTCCAGG + Intronic
1088097204 11:106115157-106115179 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1088191660 11:107234491-107234513 TTCTTTTGAGAGACAGTTCTTGG - Intergenic
1088336443 11:108709711-108709733 TTTTTCAAAGAACCAGCTCTTGG + Intronic
1088351765 11:108897692-108897714 TTTTTTTAAGAGACAGTCTAAGG + Intronic
1088407612 11:109498663-109498685 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1088449355 11:109965367-109965389 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1088463749 11:110111546-110111568 TTTTTTTCTGAGACAAGTCTTGG + Intronic
1088829807 11:113526520-113526542 TTTTTCTCAAAGTCAGCTCTTGG - Intergenic
1088836655 11:113583388-113583410 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1089402758 11:118173932-118173954 TTTTTTTAAGAGACAGGGTTTGG + Intronic
1089468816 11:118704596-118704618 TTTTTCTTACAGACAGCGCTGGG + Intergenic
1089903606 11:122013608-122013630 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1089961801 11:122623275-122623297 TCATTTTAAGAGGCAGCTCAGGG + Intergenic
1090209493 11:124908051-124908073 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1090310739 11:125735486-125735508 TTTTATCAGGAGACAGCACTAGG - Intergenic
1091438143 12:490301-490323 CTTTTTAAAGAAACAGCTTTTGG - Intronic
1092093283 12:5821650-5821672 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1092330861 12:7586089-7586111 TTTTTTGAAGAAACAGCTCTTGG - Intergenic
1092352557 12:7767536-7767558 TATTTTTAAGAGACGGCAGTGGG - Intronic
1092381560 12:8000938-8000960 TCCTTTTGAGAGACAGCTCCTGG + Intergenic
1092530996 12:9344896-9344918 TTTTTTTGAGAGACAGTACCAGG + Intergenic
1092587203 12:9911790-9911812 TTTTTTTAAGAGACAGGGCTAGG + Intronic
1092637001 12:10462122-10462144 TTTTTTCAAAAAACAACTCTTGG + Intergenic
1093031870 12:14295950-14295972 TTTTTTTAAGAGACAGCTGTTGG - Intergenic
1093036336 12:14335683-14335705 CCCTTTTGAGAGACAGCTCTTGG + Intergenic
1093048924 12:14484968-14484990 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1093049671 12:14490963-14490985 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1093347867 12:18062372-18062394 ATTTTTTAAAAGACAACTCTTGG + Intergenic
1093642331 12:21542057-21542079 TTTTTTTATGAGACAGCCTGAGG + Intronic
1093796048 12:23312977-23312999 TTTTTCAAAGAGCTAGCTCTTGG - Intergenic
1093952705 12:25182045-25182067 TTTTTCAAAGAGACACCTGTAGG + Intronic
1093964540 12:25310956-25310978 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1094102529 12:26779262-26779284 TCCTTTGGAGAGACAGCTCTTGG + Intronic
1094194767 12:27736806-27736828 TTTTTAAAAGAATCAGCTCTAGG + Intronic
1094592673 12:31836299-31836321 CTTTATTAAGAGTCAGCTATTGG - Intergenic
1094602943 12:31926418-31926440 TTTTTTTAAGAGACAGGGTCAGG + Intergenic
1094744664 12:33331192-33331214 TGTTTTTAAGGGACAGGCCTAGG - Intergenic
1095121506 12:38424844-38424866 TCTTTTTGAGAGGCAACTCTTGG - Intergenic
1095157350 12:38873966-38873988 TTTTTTTAAGAGACGGGGTTGGG + Intronic
1095368305 12:41435473-41435495 TTTTTTTAAAAGTCAGATCAAGG - Intronic
1095603853 12:44044334-44044356 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1095753383 12:45735237-45735259 TTCTTTTAAGAGAAAGCCTTAGG + Intronic
1095754765 12:45752531-45752553 TTTTTTTAAGAGACAGGGTCTGG + Intronic
1095856241 12:46863675-46863697 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1095931221 12:47627343-47627365 TTTTTAAAAAAAACAGCTCTTGG - Intergenic
1096288712 12:50322960-50322982 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1096435583 12:51588809-51588831 TTTTTTTAAGAGACAGGTTCTGG + Intergenic
1097437839 12:59572254-59572276 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1097470937 12:59990496-59990518 TTTTCTGAAGAGACAACTGTGGG - Intergenic
1097536596 12:60879371-60879393 TTTTTTAAAGAAACACCTTTTGG - Intergenic
1097598259 12:61661256-61661278 TTTTTTTAAACACCAGCTCTGGG + Intergenic
1097613940 12:61861271-61861293 TTTTTTTAAGAGAAAGGGCCTGG + Intronic
1097821342 12:64131864-64131886 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1097843358 12:64342761-64342783 TCCTTTTGAGAAACAGCTCTTGG - Intronic
1097901096 12:64874692-64874714 TTTTTTTTACAGAGAGCTCTTGG - Intronic
1097929529 12:65169291-65169313 GTTTAGTAAGAGACAGCTCCCGG + Intergenic
1097966193 12:65584000-65584022 TATTTTTATGACCCAGCTCTTGG + Intergenic
1098043615 12:66378090-66378112 TTTTTTTAAAAGATACCTCATGG - Intronic
1098128065 12:67320632-67320654 TTTCTTTTAGATCCAGCTCTGGG + Intergenic
1098158367 12:67623617-67623639 TTCTTTTAAGAAACAGCTTTTGG + Intergenic
1098193304 12:67973948-67973970 TTTTTTTAAAAAACAGCTCCTGG + Intergenic
1098194275 12:67983399-67983421 TCTTTTTAAAAACCAGCTCTCGG - Intergenic
1098673040 12:73254244-73254266 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1098716089 12:73829815-73829837 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1098731050 12:74037348-74037370 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
1098807195 12:75034973-75034995 TCCTTTTAAGAAACAGCTCTTGG + Intergenic
1098831905 12:75374025-75374047 TCATTTTGAGAGAAAGCTCTTGG - Intronic
1099011840 12:77300852-77300874 TTTTTTTAAAACTCAGCTGTAGG - Intergenic
1099091393 12:78314577-78314599 TTTTTTTAACAGCCAACTTTTGG + Intergenic
1099183380 12:79492588-79492610 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1099365923 12:81765384-81765406 TCCTTTCGAGAGACAGCTCTTGG + Intergenic
1099375648 12:81893957-81893979 TATTTTTAAGAGACAGCTCTTGG + Intergenic
1099379382 12:81936540-81936562 TCTTTTTGAGAGGCAGCTCTTGG - Intergenic
1099508560 12:83507187-83507209 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1099735784 12:86565039-86565061 TCTTCTTGAGAGACAGCTCTTGG + Intronic
1100170254 12:91967722-91967744 TTTATCTATGACACAGCTCTGGG - Intergenic
1100231949 12:92617854-92617876 TTCTTTCAAGAAACAGCTTTTGG + Intergenic
1100241153 12:92711608-92711630 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1100766779 12:97875081-97875103 ATTTATTAAAAGAAAGCTCTCGG + Intergenic
1100895847 12:99181619-99181641 TTTTTTCAAGAGAAAGTTTTAGG + Intronic
1100943723 12:99755056-99755078 TTTTTTTAAAAAGCAGCTCCTGG - Intronic
1101110366 12:101480684-101480706 TTATTTTAAGAGAGTGCTTTGGG + Intronic
1101184919 12:102265884-102265906 TTTCTTTAAGAGCTAGCTCTGGG + Intergenic
1101190783 12:102330244-102330266 TTTTTTTAAGGAACAGCTGATGG + Intergenic
1101264130 12:103066122-103066144 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1101534668 12:105606104-105606126 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1101543071 12:105682636-105682658 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1101572399 12:105965922-105965944 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1101688971 12:107056966-107056988 TTTTTTTTAGTGACATCTTTTGG - Intronic
1101832489 12:108270099-108270121 TTTTTTTAAGGGAGTGCCCTTGG - Intergenic
1102045443 12:109827149-109827171 ATTTTTTAACAGACAGCTTACGG + Intronic
1102211235 12:111128689-111128711 GCTTTTTGAGAAACAGCTCTTGG - Intronic
1102534873 12:113574121-113574143 TATTTTTATCAGATAGCTCTGGG + Intergenic
1102643242 12:114385090-114385112 TTTTTTTTGGCAACAGCTCTTGG - Intronic
1103035611 12:117654063-117654085 TCCTTTTAAGAGACAGCTCTTGG + Intronic
1103158790 12:118710223-118710245 TCTTTTTAACAACCAGCTCTTGG + Intergenic
1103352498 12:120294564-120294586 TTCTTTTTTGAGACAGCTTTTGG + Intergenic
1103354678 12:120311033-120311055 TTTTTTTAAGAGACAGGGTCAGG - Intronic
1103511673 12:121479147-121479169 TTTTTTTAAGAGATGGGGCTTGG + Intronic
1105640479 13:22258544-22258566 TTTTTTTAAGATAGATCTGTTGG + Intergenic
1105740108 13:23315176-23315198 TCCTTTTGAGAGACAACTCTTGG + Intronic
1105748193 13:23397137-23397159 TTTTTTTAACAGAGAGAACTAGG - Intronic
1106010321 13:25814605-25814627 TTTTTTTAATTGAATGCTCTCGG - Intronic
1106164382 13:27229863-27229885 TTTTTTTTTGAGACAGCACCTGG - Intergenic
1107230286 13:38101326-38101348 TCTTTTTAACAAACAGATCTTGG + Intergenic
1107494715 13:40914804-40914826 TTTTTTTATTGGACAGCTATTGG - Intergenic
1107551170 13:41477276-41477298 TTTTTTAAAAAAACAGCTCCTGG + Intergenic
1107983577 13:45755972-45755994 TCCTCTTGAGAGACAGCTCTTGG - Intergenic
1108302435 13:49091985-49092007 TCCTTTGGAGAGACAGCTCTTGG - Intronic
1108510359 13:51150229-51150251 ATTTTTTAACAGGCAGCCCTTGG + Intergenic
1108904277 13:55449971-55449993 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1108914302 13:55588871-55588893 TCCTTTTGAAAGACAGCTCTTGG - Intergenic
1108998591 13:56766347-56766369 TTTTTTTAAAAAACAGCTCCTGG - Intergenic
1109293224 13:60500118-60500140 TTTTTTTGAGAGACGGCTCTTGG + Intronic
1109519021 13:63484801-63484823 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1109583047 13:64366167-64366189 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1109712681 13:66180822-66180844 TGATTTTTAGAGACAGCTCTTGG - Intergenic
1109838991 13:67898654-67898676 TTATTTTAAAAAACAGCTCTTGG - Intergenic
1109928556 13:69182032-69182054 TTTTTTTAAGACACAAATTTTGG + Intergenic
1109951025 13:69502205-69502227 ACCTTTTGAGAGACAGCTCTTGG - Intergenic
1110065643 13:71101954-71101976 TTATTTTAAGAGACATCTAGTGG - Intergenic
1110256713 13:73440984-73441006 GTTTTTTAAGAGACAGGGCTAGG - Intergenic
1110286705 13:73758070-73758092 TTTTTTTTAGAGACAGGGGTTGG + Intronic
1110377172 13:74806469-74806491 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1110715461 13:78698225-78698247 TTTTTTTAAGATAGATCACTAGG + Intergenic
1110834136 13:80064629-80064651 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1111183365 13:84697155-84697177 TTTTTTCAAAAAACAGCTCCTGG - Intergenic
1111271119 13:85887240-85887262 TATTTTTAAGAGACTGATCATGG + Intergenic
1111862097 13:93720502-93720524 TCTTTTCAAGAAACAGCTCCTGG + Intronic
1112116973 13:96366707-96366729 TTTTTTTAAGCAACGGTTCTTGG - Intronic
1112231127 13:97590164-97590186 TTCTTTTGAGAGATAGCTCTTGG - Intergenic
1112249929 13:97770278-97770300 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1112389889 13:98973577-98973599 TTCTTTTCAGAGACACCTTTTGG - Intronic
1112457834 13:99577758-99577780 TTTTTTTAACAGACAATTTTAGG + Intergenic
1112469540 13:99675036-99675058 TTTTTTTAAGAGACAGGGTCTGG - Intronic
1112913513 13:104519334-104519356 TTTTTTAAAAAAACAGCTCCTGG + Intergenic
1113401373 13:109997078-109997100 TTTTTCTAAAAGAAATCTCTGGG - Intergenic
1114205870 14:20570769-20570791 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1114396695 14:22370064-22370086 TTTTTTTGAGAAACAGCTCTTGG - Intergenic
1114586485 14:23818714-23818736 TTATTTATAGAAACAGCTCTAGG - Intergenic
1115018189 14:28641888-28641910 TCTTTTCAAAAAACAGCTCTGGG + Intergenic
1115044965 14:28980791-28980813 ATTTTTCAAAAAACAGCTCTTGG - Intergenic
1115059715 14:29173894-29173916 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1115130692 14:30049260-30049282 TCCTATTAAGAGACAGCTCTTGG + Intronic
1115143399 14:30199387-30199409 TTCTTTTGAGAGGCAACTCTTGG + Intergenic
1115710487 14:36045525-36045547 TTTTTTGAATACACAGTTCTTGG + Intergenic
1115822977 14:37232068-37232090 TTTTTTTTAGAGACAGTGTTTGG - Intronic
1116022572 14:39479249-39479271 TTTTTTTAAAAACCAGCTCCTGG + Intergenic
1116058907 14:39896938-39896960 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1116060147 14:39913145-39913167 CTTTTATAGGAGACAGTTCTTGG - Intergenic
1116119857 14:40708805-40708827 TCTTTTCAAGAAACAGCTTTGGG - Intergenic
1116158380 14:41236665-41236687 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1116174705 14:41453143-41453165 TGTTTTTAAAAGATGGCTCTTGG - Intergenic
1116531455 14:45978225-45978247 TTCTTTTGAGAAAGAGCTCTTGG - Intergenic
1116841679 14:49824605-49824627 TTTTTTTAAGAGACGGGGTTTGG + Intronic
1117001598 14:51376312-51376334 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1117216842 14:53560175-53560197 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1117634132 14:57724373-57724395 TCCTTTTGAGAGACAGCTGTTGG + Intronic
1117780115 14:59223384-59223406 TCCTTCTGAGAGACAGCTCTTGG - Intronic
1118018774 14:61689633-61689655 TTTCTTTAAGAGACAGGGTTAGG + Intergenic
1118188481 14:63559093-63559115 TTTTTGTAAGAAAGAGTTCTGGG - Intergenic
1118208075 14:63742067-63742089 TTTTTTAAAGAAAGAGTTCTTGG - Intergenic
1118410509 14:65472268-65472290 TCTTTTTAACAACCAGCTCTTGG + Intronic
1118627563 14:67673658-67673680 TTTATTTAAGAGTCAGAGCTTGG - Intronic
1118804164 14:69220568-69220590 TTTTTTAAAGAGACAGAGTTGGG + Intronic
1118880775 14:69824018-69824040 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1119107565 14:71938839-71938861 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1119144332 14:72296691-72296713 TCTTTGTAAGATACAGGTCTGGG + Intronic
1119974198 14:79007423-79007445 TTTTTTTCAGAGACAATTCTAGG - Intronic
1120169406 14:81233986-81234008 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1120231423 14:81845251-81845273 TTCTTCTGAGAGACAGCTGTTGG - Intergenic
1120250741 14:82059649-82059671 TCTTTTTGAGAGACCACTCTTGG - Intergenic
1121676604 14:95758735-95758757 TATTTTTATGATCCAGCTCTGGG - Intergenic
1122150541 14:99723608-99723630 AGTTTTTAAAAGAAAGCTCTAGG - Intronic
1122380672 14:101304166-101304188 TTTTTTAAAGAACCAGCTTTTGG - Intergenic
1123000527 14:105291695-105291717 TTTTTTTAAGAGACAGGGTCTGG + Intronic
1123765379 15:23472627-23472649 TTTTTTTGAGAAACAGTTATTGG - Intergenic
1124514018 15:30350792-30350814 TTTGTTCCAGAGACAGGTCTGGG - Intergenic
1124728903 15:32179973-32179995 TTTGTTCCAGAGACAGGTCTGGG + Intergenic
1124793803 15:32755931-32755953 ATTTTTTAAGTGAAAGCTTTGGG + Intergenic
1124889667 15:33720860-33720882 TTTTTTTAAGAGACAGGGTCTGG - Intronic
1125528819 15:40397393-40397415 TTTTTTTAAGAGACGGACCAAGG + Intergenic
1125573120 15:40736299-40736321 TTTTTTTAAGAGATTACTCAAGG + Exonic
1125698158 15:41656776-41656798 TTTCTTTAAGAGACAGGGTTGGG + Intronic
1125765614 15:42133634-42133656 TCTTTTTAACAACCAGCTCTTGG + Intergenic
1125881124 15:43196984-43197006 TCGTTTTAACAGCCAGCTCTGGG - Exonic
1125895158 15:43295774-43295796 TGTTGTTAAGAGACAGATCAAGG - Intronic
1125915274 15:43481513-43481535 TTTTTTTAAGAGACAGAGTCTGG + Intronic
1126039405 15:44575840-44575862 TTTTTTTAAAACGAAGCTCTTGG + Intronic
1126283609 15:46986277-46986299 TCCTTTTAAGAAACAACTCTTGG + Intergenic
1126294300 15:47120042-47120064 TTTTTTTCAGGGACAGTTTTAGG - Intergenic
1126296273 15:47139459-47139481 TTTTTCTCACATACAGCTCTGGG + Intergenic
1126298802 15:47171630-47171652 TTTTTTTCATGGACACCTCTGGG - Intergenic
1126447440 15:48764383-48764405 TTGTTTAAAGAGACAGCTATTGG - Intronic
1126612704 15:50545929-50545951 TTTTTTTAAGTGATTGATCTAGG + Intronic
1126666176 15:51077890-51077912 ATTTATTAAAAGAAAGCTCTCGG - Intronic
1126876889 15:53052812-53052834 TTTTTTCAAAAAACAGCTCCTGG - Intergenic
1127445622 15:59060166-59060188 TGTTTTTAAAAGACACCCCTGGG - Intronic
1127725615 15:61746461-61746483 ATTTTTTAAGTGAAAGCTGTAGG - Intergenic
1127821600 15:62662125-62662147 TTTTTTAAAGAGCCAGCTTTTGG - Intronic
1127950309 15:63798997-63799019 TTTTTTAAAGCGTCATCTCTGGG + Intronic
1128137929 15:65277761-65277783 AATTTTTAAGAGACTGCTTTGGG + Intronic
1128386456 15:67152606-67152628 TTTTTTTAAGAGATCACTCATGG - Intronic
1128540757 15:68529659-68529681 TCTTTTTAAAAGTCAGCTTTTGG + Intergenic
1130645279 15:85720051-85720073 TTTTTTGTAGAGACAGCTCTTGG - Intronic
1130933924 15:88452892-88452914 TTTTTTAAAGAGAGAGATTTGGG - Intergenic
1131232352 15:90668721-90668743 ATGTTTTCAGAGATAGCTCTGGG + Intergenic
1131477315 15:92751113-92751135 TTTTTTTAATAGCCAGGTGTGGG + Intronic
1131700241 15:94927745-94927767 ATTTAATAAGAGACAGCTATAGG + Intergenic
1131724009 15:95202795-95202817 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1132140879 15:99393750-99393772 TTTTTCTAAGAACCAGCTTTTGG - Intergenic
1132140885 15:99393830-99393852 TTTTTCTAAGAACCAGCTTTCGG - Intergenic
1132206307 15:99988306-99988328 TTTTTTAAACAACCAGCTCTTGG - Intronic
1132507594 16:319448-319470 TTTGTTTATGACACAGCTCCTGG - Intronic
1132766245 16:1535814-1535836 TCTTTTTAAAAGACGGCTGTTGG - Intronic
1134259393 16:12638594-12638616 TCTTTTTTAGAGACAGGTCTTGG - Intergenic
1134460101 16:14423130-14423152 TTTTTTTAAAAAAGAACTCTTGG - Intergenic
1134647623 16:15882851-15882873 TTCTTTTAAGAGACAGGAGTTGG + Intronic
1134680831 16:16124157-16124179 TCTTGTTACGAGACAGATCTGGG - Intronic
1134795615 16:17033483-17033505 TTTATTTAAGAGATAGTTCTTGG - Intergenic
1134813562 16:17187553-17187575 TTTTTTTTTGAGACAGCGTTTGG - Intronic
1135099171 16:19591413-19591435 TTTTCTTAAGAGACTGTTATGGG + Intronic
1135626002 16:23995496-23995518 TCCTATTAAGAGACAGCTCTTGG + Intronic
1135798302 16:25467809-25467831 TTTTTTTAAAAAAGAGTTCTGGG - Intergenic
1136250941 16:29004591-29004613 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1137361796 16:47824396-47824418 TTTTTTTAAGTGTCTGCTCTAGG - Intergenic
1137460533 16:48657661-48657683 TTTTTTTAAGAATCAACTTTTGG + Intergenic
1137652810 16:50134948-50134970 TTTCCTTTTGAGACAGCTCTTGG - Intergenic
1138168178 16:54822155-54822177 TTTTTTTAAGAAAAATATCTAGG - Intergenic
1138240141 16:55421004-55421026 ATATTTTAAGAGACAGAACTGGG + Intronic
1138318837 16:56093763-56093785 TCTTTTTGAGAGACAGATCTCGG - Intergenic
1138408301 16:56816879-56816901 GTTTCTTAACAGCCAGCTCTTGG - Intronic
1138686061 16:58726851-58726873 TTTTTTAAAGAGATGGATCTCGG + Intronic
1138710735 16:58967563-58967585 TTTTTTTTGGAGACAGGGCTTGG - Intergenic
1138885482 16:61072766-61072788 TTTTTTTAAAATACAACTTTAGG + Intergenic
1140062490 16:71582888-71582910 TTTTTTTAAGAGGCAGGGCCTGG + Intergenic
1140088425 16:71817213-71817235 TTTTTTAAAGAGGCAGCCCTAGG + Intergenic
1140292261 16:73670992-73671014 ATTATTTAAGAAACAGCTATGGG + Intergenic
1140523030 16:75598416-75598438 CTTCGTTAAGAAACAGCTCTAGG + Intronic
1140687220 16:77445051-77445073 TTTTTTTAAGAGACAGAGGCTGG - Intergenic
1140736558 16:77903108-77903130 TGTTTTTAATAGACATCTCCTGG + Intronic
1141002418 16:80320452-80320474 TTTTTTTAACATACTTCTCTGGG - Intergenic
1141145347 16:81525527-81525549 TTTTTTTAAGAGACAGAGTATGG + Intronic
1141384157 16:83603983-83604005 TTTTATCATGAGACAGCACTAGG + Intronic
1141559544 16:84858038-84858060 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1141727914 16:85801941-85801963 TTTTATTAAGAGATGGCTCCTGG + Intronic
1143050116 17:4118350-4118372 TTCTTTTGAGAGACAGCTCCGGG - Intronic
1143728105 17:8863985-8864007 TGTTTTTAAGGGACAGCGTTTGG + Intronic
1143728992 17:8869686-8869708 TCTTTGCAAGGGACAGCTCTGGG - Intergenic
1144711802 17:17406148-17406170 TTGTTTGAAGAGACAGCTCTGGG - Intergenic
1144994147 17:19255576-19255598 TTTTTTTAAGTGCCAGTGCTTGG + Intronic
1145079959 17:19886614-19886636 TTTTTTGTAGAGACAGGTCAGGG + Intergenic
1145966609 17:28923354-28923376 TTTTTTTAAAAGATAATTCTGGG + Intronic
1146492094 17:33290975-33290997 TTTTTTTAAGAGCCGTCTATTGG + Intronic
1146709173 17:35026238-35026260 TTTGTGAAAGGGACAGCTCTGGG + Intronic
1146758135 17:35451018-35451040 TTTTTTTTAGTGGTAGCTCTAGG - Intergenic
1146836354 17:36114000-36114022 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1147130754 17:38407089-38407111 TTTTTTTAAGGGACAAGACTGGG - Intergenic
1147949375 17:44098424-44098446 TTTTTTTAAGAGACAGCCCTGGG - Intronic
1147950157 17:44102976-44102998 TTTATTTAAGAGACAGCCCTAGG + Intronic
1148119620 17:45200646-45200668 TTTTTTTGACAGACAACTCAGGG - Intergenic
1148156458 17:45427625-45427647 TTTATTCAAGAGGCAGCTGTGGG - Intronic
1148924288 17:51069161-51069183 TTTTTTAATGAGGCAGCTTTAGG - Intronic
1149636883 17:58178234-58178256 TTTTTTAAAGAGGCAGGACTAGG + Intergenic
1149825132 17:59821454-59821476 TATTTTTAGGAGACAGATGTTGG + Intronic
1150519852 17:65854956-65854978 TTTTTTTAAAAAAAAGCTCAGGG + Intronic
1150568740 17:66366849-66366871 TTTTTTTAAAAGACTGATTTTGG - Intronic
1150909478 17:69372910-69372932 TTTTTTTAAAAGAGAGATCCAGG + Intergenic
1151044629 17:70904783-70904805 TTTTTCTTTGAGACAGATCTTGG - Intergenic
1151308053 17:73276491-73276513 TTTTTTTTTGAGACAGATCCTGG + Intergenic
1151594580 17:75069566-75069588 TTTTTTTAAGAGACAGGTTCTGG - Intergenic
1151636381 17:75351469-75351491 TTTTTTGTAGAGACAGGTCTTGG - Intronic
1152439870 17:80300274-80300296 TTTTTTTAAGAGACAGAGTCTGG + Intronic
1153057037 18:956041-956063 TTTTATTAAAAAATAGCTCTAGG + Intergenic
1153217694 18:2835606-2835628 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1153421277 18:4908162-4908184 CATTTTTAAGTGACAGATCTGGG + Intergenic
1153427588 18:4983395-4983417 TTTTTTCAAAAAACAGCTCCTGG - Intergenic
1153791088 18:8580355-8580377 TATTTTTAAAGAACAGCTCTAGG - Intergenic
1154068464 18:11131095-11131117 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1154252672 18:12757279-12757301 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1154366970 18:13720118-13720140 CTCTTTTAAGAAACAGCTTTTGG - Intronic
1154506171 18:15042886-15042908 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1155940706 18:31799594-31799616 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1156303859 18:35858690-35858712 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1156462302 18:37327823-37327845 ATTATTTCAGAGACAGCACTGGG - Intronic
1156601371 18:38611178-38611200 TTTCTTTAAGGGAAAGCTCTTGG - Intergenic
1156664927 18:39393289-39393311 TTTTTTAAAAAAACAGCTCCTGG - Intergenic
1156698784 18:39799151-39799173 GCCCTTTAAGAGACAGCTCTAGG + Intergenic
1156990304 18:43400779-43400801 TCTTTTTGAGAGATGGCTCTTGG - Intergenic
1157321600 18:46639103-46639125 TTATTTCAAGTGACATCTCTGGG - Intronic
1157341201 18:46780023-46780045 TCCTTTTGAGAGACAACTCTTGG + Intergenic
1157900591 18:51512708-51512730 ATTTTTTAAAAAACAGCTCCTGG + Intergenic
1157998505 18:52588128-52588150 TCTGTTTAAGAGACAGCTCTTGG - Intronic
1158109754 18:53928366-53928388 TTTTTTTAAGACAAAACTCCAGG + Intergenic
1158327983 18:56330769-56330791 TGTTATTTAGAGACAACTCTGGG - Intergenic
1158580260 18:58674561-58674583 TTTTTTCAAAAAACAGCACTGGG + Intronic
1158673232 18:59495618-59495640 TTTTTTTAAGAAACTTGTCTTGG + Intronic
1158832720 18:61297799-61297821 TCTGTTTTAGAGACTGCTCTAGG + Intergenic
1159152206 18:64535042-64535064 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1159464123 18:68758709-68758731 TTTTTTTGAGAAATAGCTCCTGG + Intronic
1159559106 18:69975355-69975377 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1159663454 18:71128130-71128152 TCTTTTTAAAAAACAGCTTTTGG + Intergenic
1159711300 18:71764120-71764142 TACTTTTGAGAGACAACTCTTGG + Intronic
1160092462 18:75840011-75840033 TCCTCTTGAGAGACAGCTCTTGG + Intergenic
1160655196 19:263076-263098 TCTTTTTAACAGCCTGCTCTTGG - Intergenic
1160655210 19:263186-263208 TCTTTTTAACAGCCTGCTCTTGG - Intergenic
1160655226 19:263296-263318 TGTTTTTAACAGCCTGCTCTTGG - Intergenic
1161071218 19:2262258-2262280 TTTTTTAAAGAGATAGGGCTGGG + Intronic
1162241736 19:9360703-9360725 TTTTTTTAAAAGACTACTTTAGG - Intronic
1162615051 19:11792843-11792865 TTTTTTTAAGAGACAGGGTTGGG - Intergenic
1162723831 19:12677950-12677972 TTTTTTAAAGAGCCAGCTTGTGG + Intronic
1162990219 19:14297151-14297173 TTTTTTTAAGAGACGGGGTTGGG + Intergenic
1163125185 19:15240621-15240643 GTTTCCTAAGAGACAGCTCCAGG - Intronic
1163302171 19:16454827-16454849 TTTTTTTAAGAGACAGCTCTGGG + Intronic
1163764415 19:19154775-19154797 TTATTTTAAGACTCAGCTCATGG + Intronic
1163794570 19:19329778-19329800 TTTTTTTAAGAGACAGGGTCTGG - Intronic
1163864906 19:19764880-19764902 TTTTTTTTTGAAACAGCTTTTGG + Intergenic
1164097087 19:22021347-22021369 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1164117259 19:22234578-22234600 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1164163524 19:22647576-22647598 TTTTTTCAAAAAACAGCTCCTGG + Intronic
1164808231 19:31134349-31134371 CATTTTTAAGACACATCTCTGGG + Intergenic
1165047361 19:33116039-33116061 TTTTTTTTAGTGATTGCTCTAGG + Intronic
1165076043 19:33280556-33280578 CCTTTTCAAGAGACAGCTCTTGG - Intergenic
1166085445 19:40471748-40471770 TTTTTTTAAAAGACAGTTTCTGG + Intronic
1167570581 19:50286146-50286168 TTTTTTTAAGACACAGTAATTGG - Intronic
1167714420 19:51132125-51132147 TCTTTTTAACACCCAGCTCTTGG - Intronic
1168273104 19:55260837-55260859 TTTTTTTAAGAGACAGGGTCTGG + Intergenic
1168303847 19:55423034-55423056 TTTTTTTATGAGACAGGTTCTGG + Intergenic
1168446448 19:56419802-56419824 TGTTTTTAAAAAACAGCTGTAGG + Intronic
1168539337 19:57197374-57197396 TCCTTTTGAGAGACAGCTCTTGG - Intronic
925008174 2:461599-461621 TTTCTTTGAGACAAAGCTCTGGG - Intergenic
925279952 2:2676864-2676886 TTCTTTTGAGAGACAGCACTTGG + Intergenic
925854617 2:8117466-8117488 TATTTTTAAGAGAAAGCAATAGG + Intergenic
926275771 2:11402147-11402169 TTTTTTAAAGAAAAAGCTTTAGG + Intergenic
926465978 2:13188965-13188987 GTTTTGTAATAGACAGCTCACGG + Intergenic
926810397 2:16750680-16750702 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
926825566 2:16902234-16902256 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
926826761 2:16913664-16913686 TCCTTTTGAGAGACAGATCTTGG + Intergenic
927008716 2:18879720-18879742 TCCTTTTGACAGACAGCTCTTGG + Intergenic
927534079 2:23838436-23838458 TTTTTTTTAAAGACAACTTTTGG - Intronic
927660431 2:24988665-24988687 TCCTTTTGAGAGACGGCTCTTGG + Intergenic
928491282 2:31785911-31785933 TGTTTTAATGAGACAACTCTTGG + Intergenic
928800253 2:35080624-35080646 TCATTTTTAGAGACAGCTCCTGG + Intergenic
928981669 2:37142308-37142330 TTTTTTGTAGAGACAGCGTTTGG + Intronic
929209995 2:39345402-39345424 TTTCTTTAAGATTCAGATCTCGG - Intronic
929269827 2:39960785-39960807 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
929353737 2:40993807-40993829 TTTTTTTAAAAAAAAACTCTTGG - Intergenic
929550260 2:42886028-42886050 TCCTTTTGAGAGACAACTCTTGG + Intergenic
929752348 2:44728855-44728877 TTTTTTTGAGAACCAACTCTTGG + Intronic
929767737 2:44862651-44862673 CTTTTTGAAGAAACAGCTTTTGG - Intergenic
929833440 2:45370708-45370730 TTTTTTCAAGAAAGAGCCCTAGG - Intergenic
929982246 2:46692361-46692383 ATTTTTTAAAAGAGTGCTCTGGG - Intergenic
930760922 2:55034962-55034984 ATTTTTTAAGAGGCTGTTCTAGG - Intronic
931323890 2:61198568-61198590 TTTTTTTAAGAGAGAGAAATAGG + Intronic
931514396 2:63036941-63036963 TTTTTTTCATAGATAGCTGTGGG + Intronic
931824503 2:65985831-65985853 TTTTTATAAGAGATGACTCTTGG + Intergenic
932079960 2:68704949-68704971 TTTCTTTAAGAGAGAGCTCTAGG - Intronic
932106612 2:68948884-68948906 TTTTTTTTAAAGACAGTTTTGGG + Intronic
932645756 2:73499831-73499853 TTTTTTAAACAACCAGCTCTTGG - Intronic
932713728 2:74086364-74086386 TTTTTTTAAGCGAGAGCCCTGGG - Intronic
932870708 2:75395085-75395107 TCCTTTTGAGAGACAGCTCCTGG - Intergenic
933107780 2:78354998-78355020 TCTTTTTAAAAGACTGCTTTTGG + Intergenic
933265685 2:80178384-80178406 CCTTTTTGAGAGACAGCTCTTGG - Intronic
933394464 2:81713359-81713381 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
933550214 2:83767261-83767283 TTTTTCAAAGAAACAGCTCCTGG - Intergenic
934774021 2:96925898-96925920 TTGATTAAAGAGGCAGCTCTTGG - Intronic
935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG + Intergenic
935425111 2:102911329-102911351 TCCTTTTGAGATACAGCTCTTGG - Intergenic
935564310 2:104590255-104590277 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
935577421 2:104725307-104725329 TTCTTTTGAGAAACAGATCTTGG + Intergenic
935862818 2:107351700-107351722 TTTTTTTAACAGAAAACTTTAGG - Intergenic
935944631 2:108274367-108274389 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
936641225 2:114314688-114314710 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
936995399 2:118409106-118409128 TTTTTTTAAGACACAAAACTAGG - Intergenic
937003290 2:118488226-118488248 GAATTTTAAGAGACAGCTCAGGG - Intergenic
937372552 2:121310707-121310729 CTTTTCAAAGAGCCAGCTCTTGG - Intergenic
937582065 2:123499169-123499191 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
937770672 2:125716992-125717014 TTTTTGTAGGACAGAGCTCTGGG - Intergenic
937785207 2:125887730-125887752 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
937800326 2:126074726-126074748 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
937817285 2:126265205-126265227 TTCTATTTAGAGACATCTCTAGG - Intergenic
937852571 2:126648740-126648762 TCCTTTTGAGAGACAGCACTTGG - Intergenic
938102928 2:128510740-128510762 TTTTTTAAAAAGTCAGCTCATGG - Intergenic
938254722 2:129847583-129847605 CTTTTAGAATAGACAGCTCTTGG + Intergenic
938375538 2:130803370-130803392 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
939213871 2:139212238-139212260 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
939560940 2:143730877-143730899 TTTTTTTAAAGGAGTGCTCTAGG - Intronic
939646569 2:144706790-144706812 TTTTTTCAAGTGACTGCTTTGGG - Intergenic
939788687 2:146546115-146546137 TCCTTTTGAGAGACAACTCTTGG - Intergenic
939806239 2:146778472-146778494 TCCTTTTGAAAGACAGCTCTCGG + Intergenic
939806619 2:146781560-146781582 TTTATTTAAGAAACTGGTCTTGG - Intergenic
940080776 2:149798472-149798494 TGTTTTTAAGAAAATGCTCTTGG - Intergenic
940171314 2:150832714-150832736 TCCTTTTGAGATACAGCTCTTGG - Intergenic
940459918 2:153951995-153952017 GTTTTTTAAAGGACTGCTCTTGG + Intronic
940607208 2:155941302-155941324 TTTTTTTAAAAAACAGCTCCTGG - Intergenic
940792350 2:158042517-158042539 TTTCTTAAACAGACAGCTGTGGG + Intronic
940831161 2:158467666-158467688 TTTTTTTTAGAGACAGCGTCTGG - Intronic
940933906 2:159469160-159469182 TTTTTTTAAGAACAAGCTTTTGG - Intronic
940994411 2:160132505-160132527 TGTTTTTAAAAGACAGCGTTAGG - Intronic
941791529 2:169557353-169557375 TTTTTTTAAATAACAGTTCTTGG + Intronic
942001924 2:171656340-171656362 TGTTTATAAGATTCAGCTCTTGG + Intergenic
942034882 2:172001147-172001169 TTTTTTTAAGACTCATTTCTCGG + Intronic
942582872 2:177439450-177439472 ATTTTTTAATAGACATCTTTGGG + Intronic
943006896 2:182395839-182395861 TCCTTTTGAGAGACAGCTCTTGG + Intronic
943110976 2:183605531-183605553 TTTTTTTAGGTGAGAGCTATAGG - Intergenic
943239220 2:185362574-185362596 TCCTTTTGAGAGACAACTCTTGG - Intergenic
943264256 2:185707254-185707276 TTTTTTGAAGAACGAGCTCTTGG - Intergenic
943388129 2:187227134-187227156 TGCTTTTGAGAGGCAGCTCTTGG + Intergenic
943517599 2:188907244-188907266 TCCTTTTGAGAGACATCTCTTGG - Intergenic
943816601 2:192265273-192265295 TTTTTTTAATAGAAAATTCTGGG - Intergenic
943913902 2:193603636-193603658 TTTTTCTAATAGATACCTCTAGG + Intergenic
944112642 2:196150165-196150187 TTTTTTTTAGTCACTGCTCTGGG - Intronic
945187471 2:207154287-207154309 TTTTTTTAAGAGCCAGAATTAGG - Intronic
945226393 2:207535431-207535453 TTTTTTTAACAGACAGCTCATGG + Intronic
945544869 2:211138155-211138177 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
945642177 2:212443835-212443857 TCCTTTTGAGAGACAGCTCTTGG + Intronic
945717836 2:213380671-213380693 TCCTTTTGAGAGACAGCTCTTGG - Intronic
945847409 2:214963125-214963147 TTTTTTCAAAAAACAGCTCCTGG - Intronic
945852150 2:215021562-215021584 TTCTTAAAAGAAACAGCTCTAGG - Intronic
946527869 2:220539969-220539991 TCCTCTTCAGAGACAGCTCTTGG - Intergenic
946609163 2:221439497-221439519 TTTTTTTAAGAGACAGGGTCTGG + Intronic
946703775 2:222437794-222437816 TCCTTTTGAGAGACAGCTCTTGG - Intronic
946736894 2:222762994-222763016 TTTTTTTAAGAGACAGAGTTAGG + Intergenic
946790920 2:223299758-223299780 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
947128582 2:226897669-226897691 TTTCTTTAAGAACCAGCTCTGGG + Intronic
947346259 2:229192235-229192257 TATTTTAAAGAAACAGATCTTGG - Intronic
947440716 2:230118668-230118690 TCCTTTTGAGAGACAGCTCCAGG - Intergenic
947440846 2:230120255-230120277 TCCTTTTGAGAGACAGCTCTGGG + Intergenic
947660889 2:231866801-231866823 TTTTTTCAACAGATGGCTCTGGG + Intergenic
947987278 2:234459759-234459781 TGTTTTTAACAACCAGCTCTTGG - Intergenic
948246035 2:236486800-236486822 TTTTTTTAAGAGATAGCATCTGG - Intronic
948384619 2:237573847-237573869 TCTTTTTAACAACCAGCTCTGGG - Intergenic
1169326693 20:4682458-4682480 TTTTTTTAATAAACAGCTGGGGG - Intergenic
1169444751 20:5662120-5662142 TTTTTTTAAGAGACAGGGCTGGG - Intergenic
1169850654 20:10046221-10046243 GTTTTTTGAGACACAGATCTTGG - Intronic
1170162302 20:13325775-13325797 TTCTGTTAAGAGTCAGTTCTCGG - Intergenic
1171084429 20:22224362-22224384 TTTTATTGAGAGACTGCTATGGG - Intergenic
1172220646 20:33272541-33272563 ATTTTTTAGGAGACAGCCCCAGG + Intergenic
1172224158 20:33293356-33293378 TATTTTTAAGAGGCTGCTCTTGG + Intronic
1173808533 20:45941762-45941784 TTTTTTTAAGAGACAGGATCTGG + Intronic
1174055868 20:47798056-47798078 TTTTTTTAAGAAACATGGCTGGG + Intergenic
1174223787 20:48979914-48979936 TTTTTTAAAAAAACAGCTCCTGG + Intronic
1174953695 20:55072205-55072227 TTTTTTAAAGAGAGAGTTTTGGG + Intergenic
1174973849 20:55308424-55308446 TTTTTCTAAAAAACAGCTCCTGG - Intergenic
1175041251 20:56053088-56053110 TTTTTTAAAAAAACAGCTCCTGG - Intergenic
1175477175 20:59285087-59285109 TCTTATTAAGAGTCAGCTGTAGG + Intergenic
1175686721 20:61034954-61034976 CTTTTCTAAGAAACAGCTTTGGG + Intergenic
1175686874 20:61037198-61037220 TTTTTTTAAAAAACATATCTAGG - Intergenic
1176791682 21:13326138-13326160 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1176998159 21:15580182-15580204 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1177139417 21:17342271-17342293 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1177189624 21:17835984-17836006 TTCTTTTAACAGCAAGCTCTTGG - Intergenic
1177505562 21:22014184-22014206 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
1177913174 21:27056208-27056230 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1177933698 21:27316934-27316956 CTTTTTTGAGAGACAGCTCTTGG - Intergenic
1177991072 21:28037140-28037162 TCTTTTTGAGAGACAGCTTGTGG - Intergenic
1178012659 21:28305173-28305195 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1178063300 21:28875359-28875381 TCTTTTTGAGAAACAGCTCTTGG - Exonic
1178372859 21:32041517-32041539 TTTTTTCAAAAAACAGCTCCTGG - Intronic
1178634465 21:34290195-34290217 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1178697987 21:34810504-34810526 GCTTTTAGAGAGACAGCTCTGGG - Intronic
1179348577 21:40584987-40585009 TCTTTTTAACAACCAGCTCTTGG - Intronic
1179383527 21:40921048-40921070 TCTCTTTTTGAGACAGCTCTTGG + Intergenic
1179956214 21:44740585-44740607 ATTTATTAAAAGAAAGCTCTTGG - Intergenic
1180591148 22:16938369-16938391 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1180652578 22:17390648-17390670 TTGTTTTTTGAGACAGGTCTTGG + Intronic
1181182965 22:21080096-21080118 TATTTTTAAAAGACAGTTTTGGG - Intergenic
1181367437 22:22388946-22388968 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1181420653 22:22795829-22795851 TGCTTTTGAGAGACAGCTGTTGG + Intronic
1181478727 22:23184098-23184120 TGTTTTTAAGAGACAGCGTCTGG + Intronic
1182822335 22:33227571-33227593 TATTTTTAAAAGACAGGTTTGGG - Intronic
1182824825 22:33255869-33255891 TTTTTTGAAGAGTCAGTTCCCGG + Intronic
1183267209 22:36835786-36835808 TGTTCTTTAGAGAGAGCTCTTGG - Intergenic
1184145212 22:42606224-42606246 TTTTTTTAAGAAACAAGGCTGGG + Intronic
1184147715 22:42621217-42621239 TGTTTTTAAGAGACAGGAATTGG + Intronic
1184603562 22:45558377-45558399 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1185033675 22:48459539-48459561 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1185396160 22:50590418-50590440 TTTTTTAAAGAACCAGCTTTTGG + Intronic
949170041 3:986606-986628 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
949245867 3:1924920-1924942 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
949417593 3:3830885-3830907 TCCTTTTGAGAGACAGCTCTTGG - Intronic
949445610 3:4131051-4131073 TCCTTTTGAGAGACAGCTCTTGG + Intronic
950168497 3:10819518-10819540 TTTTTCCTGGAGACAGCTCTGGG + Exonic
951003618 3:17592849-17592871 TCCTTTTGAGAGACAGCTTTTGG + Intronic
951122570 3:18945564-18945586 TCCTTTTGAGAGGCAGCTCTAGG + Intergenic
951384524 3:22027532-22027554 TCCTTTTGAGAGACAGCTCTTGG + Intronic
951726130 3:25762391-25762413 TGTTTTTCATAGACAACTCTTGG - Intronic
951835478 3:26978431-26978453 TTTTTTTAAGAGACAGAGTCTGG - Intergenic
951970764 3:28441868-28441890 TCCTTTTGAGAGACAGCTCTTGG - Intronic
951976583 3:28517198-28517220 TTTTTTTCAGTGCCAGCTTTGGG + Intronic
951982315 3:28578925-28578947 TTTTTTTAAGATTCTGCTTTAGG + Intergenic
952054531 3:29428558-29428580 TTTTTTTAACAGAAAGCATTTGG - Intronic
952456948 3:33482020-33482042 TTTTTTTTTGAGACAGCGTTTGG - Intergenic
953252013 3:41253478-41253500 TTTTTTTAAGTGGTTGCTCTTGG - Intronic
953479786 3:43241098-43241120 TCTATTTAAGAGACAGCAATTGG - Intergenic
954054155 3:48007957-48007979 TCCTTTTGAGAGTCAGCTCTTGG + Intronic
954417667 3:50401629-50401651 TTTTTTTAAGTGTCCTCTCTTGG - Intronic
954511492 3:51129664-51129686 TCCTTTTGAGAGGCAGCTCTTGG - Intronic
954771086 3:52969798-52969820 TTTTTTTAAAAAACAGCTTTAGG + Intronic
954834259 3:53451511-53451533 TTTATTGAAGAGAGAGGTCTGGG + Intergenic
954985658 3:54789261-54789283 TTTTTTTAAAACACATATCTTGG - Intronic
955097025 3:55809030-55809052 TTTTTTAAAAAGACTGCACTGGG - Intronic
955166598 3:56520961-56520983 TTTTTTTGAGATATAGCCCTAGG - Intergenic
955517311 3:59739266-59739288 TTTTTTCAATAGATAGTTCTTGG - Intergenic
955698044 3:61656218-61656240 TTTTTTTAAGAGACAGGGTCAGG - Intronic
956244663 3:67168983-67169005 TATTTTTAACAGACAACTTTAGG - Intergenic
956360451 3:68441435-68441457 TCCTTTTGAGAGATAGCTCTTGG + Intronic
956509660 3:69980369-69980391 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
956703896 3:71982890-71982912 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
956806507 3:72818981-72819003 TTTTTTTAAAAAACAGATGTTGG - Intronic
957247582 3:77733900-77733922 TACTTTTGAGAGACAGCTTTTGG - Intergenic
957298500 3:78361646-78361668 CCCTTTTAAGAAACAGCTCTTGG - Intergenic
957491913 3:80938552-80938574 TCTTTTTTAGAAACAGCTCTTGG - Intergenic
957646150 3:82931674-82931696 TTGTTTTAAAAAACAGCTTTTGG - Intergenic
957986707 3:87581181-87581203 TTTTTTTAAAAGACTTTTCTTGG - Intergenic
958025189 3:88041104-88041126 TGTTTTTGAGAAATAGCTCTTGG - Intergenic
958424228 3:93963170-93963192 TTCTTTTGAGAAACTGCTCTTGG + Intronic
958441268 3:94158858-94158880 TTTATTTAACTGACAGATCTTGG + Intergenic
958487679 3:94732477-94732499 TCCTTTTAAGAGACAGCTCTTGG - Intergenic
958856748 3:99394635-99394657 TTTTTGTGGGAGAGAGCTCTTGG + Intergenic
958858612 3:99418007-99418029 TTTTTTTTAAAGACAGCCCATGG - Intergenic
958947514 3:100379917-100379939 TTTTTTTAAGAGACAGGGTCAGG - Intronic
959226780 3:103597279-103597301 TCCTTTTAAGAGACAGCTTTTGG - Intergenic
959293065 3:104499470-104499492 GTTTTTTAAGAGACGGGTCTTGG - Intergenic
959377345 3:105602837-105602859 TCCTTTTGAAAGACAGCTCTTGG - Intergenic
959525482 3:107371955-107371977 TTTTTTTTAGAGACGAGTCTCGG - Intergenic
959612833 3:108314326-108314348 TTTTTTTAAGAGACAGTATAGGG - Intronic
959616121 3:108349194-108349216 TTTTTAAAAAAAACAGCTCTTGG - Intronic
959630964 3:108506721-108506743 TTTTTTGTAGAGACAGGACTGGG - Intronic
959746015 3:109777276-109777298 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
960349528 3:116575698-116575720 TCCTTTTGAGAGACAGCTCTTGG + Intronic
960494747 3:118360783-118360805 TCCTTTTGAGAGACTGCTCTTGG - Intergenic
961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
961588325 3:127954445-127954467 CTTTTCTAAGAGACAGCCCCTGG - Intronic
961710980 3:128828005-128828027 TCCTTTCGAGAGACAGCTCTTGG - Intergenic
961982985 3:131101166-131101188 TTTTTATAAGAACCAACTCTTGG + Intronic
962635799 3:137330218-137330240 TCTTGTTAAGAGGCAGCACTCGG + Intergenic
962983659 3:140514025-140514047 TTTTTTCAAAAGGCAGCTCCTGG + Intronic
963044681 3:141093981-141094003 TTTTTTTTACAGACATCTCATGG - Intronic
963075484 3:141342741-141342763 TTTTTTTAATGCACAGATCTGGG + Intronic
963331818 3:143923376-143923398 TCCTTTTGAGAGACAGATCTTGG - Intergenic
963453670 3:145516664-145516686 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
964326254 3:155549379-155549401 TTTTTTTGACAGACAGTTATTGG + Intronic
964452306 3:156824028-156824050 TTTTTTTAAGAGACAGGGTCGGG + Intergenic
964581964 3:158249338-158249360 TTTTATTTATAGAAAGCTCTAGG - Intronic
964679246 3:159318917-159318939 TCCTTTTGAGAGACAGCTCATGG - Intronic
965027789 3:163325157-163325179 GTTTGTTAAGAGACAGGGCTAGG - Intergenic
965226768 3:166000767-166000789 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
965251333 3:166348270-166348292 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
965493999 3:169375383-169375405 TTTTTTTAAAAAACAGCTCCTGG - Intronic
965688217 3:171327885-171327907 TTTTTTTATGAGCCAGGTTTGGG - Intronic
965893155 3:173540097-173540119 TTCTTCTGAGAAACAGCTCTGGG - Intronic
966044331 3:175530924-175530946 TCCTTTTGAGAGACAGCTCTTGG - Intronic
966053288 3:175649392-175649414 TTTTTTTCAGAGACACTTATGGG - Intronic
966133343 3:176669754-176669776 TTTTTTCCAGATACAGCTCTGGG - Intergenic
966257895 3:177939401-177939423 TTTTTTTAAGATATAGTTTTAGG - Intergenic
966445692 3:179998556-179998578 TCCTTTTGAGAGACAGCTCTTGG + Intronic
966475609 3:180341819-180341841 CTTTTTGAACAGACAGCTCCTGG + Intergenic
966608648 3:181846711-181846733 TTTTTTTAAGAGACAGGGTCTGG + Intergenic
966763532 3:183438039-183438061 TCATTTTGAGAAACAGCTCTTGG + Intergenic
967425987 3:189328141-189328163 TTTTTTTGAGAAACAGGTGTTGG + Intergenic
967522010 3:190443087-190443109 ATTTTTTAAGAGACAGATGTGGG + Intronic
967831775 3:193925987-193926009 CCCTTTCAAGAGACAGCTCTTGG + Intergenic
968800182 4:2738118-2738140 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
968906945 4:3457964-3457986 TCCTTTTGAAAGACAGCTCTTGG + Intergenic
969282440 4:6179706-6179728 TTCTTTTGAGTGGCAGCTCTTGG - Intronic
969444623 4:7237367-7237389 TTTTTAGAAGAGACCCCTCTTGG + Intronic
969914176 4:10473851-10473873 TTTTTTTTTGAGACAAGTCTCGG + Intergenic
970729914 4:19090512-19090534 GTTTATTAAAAGAAAGCTCTCGG - Intergenic
971109543 4:23568937-23568959 CTTTTCTAAGAAACAGCTTTTGG + Intergenic
971688802 4:29805760-29805782 TTTTATTGAAAGATAGCTCTAGG - Intergenic
971753927 4:30683650-30683672 TTTTATCATGAGACAGCACTAGG - Intergenic
971858173 4:32070420-32070442 TTTTTTTAAGAAGCTACTCTTGG + Intergenic
971897539 4:32617002-32617024 TCCTTTTGAGTGACAGCTCTTGG + Intergenic
971903097 4:32688302-32688324 TGTTTTTAAGAGAGAGGACTTGG - Intergenic
971979296 4:33732876-33732898 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
972070033 4:35007341-35007363 TTTATTTCAGAGACAGCAATAGG + Intergenic
972094048 4:35326091-35326113 TCTTTTTGAGACACAACTCTTGG + Intergenic
972124347 4:35744338-35744360 TTTTTAAAAGAAACAGCTCCTGG - Intergenic
972645156 4:40960946-40960968 TTTTTTTAAAGGAGGGCTCTTGG - Intronic
972805915 4:42529324-42529346 TCCTTTTGAGAGACAGCTCTTGG + Intronic
973040793 4:45467937-45467959 ATTTTTTAAGAAGCAGCTCCAGG - Intergenic
973098051 4:46226757-46226779 ACCTTTTGAGAGACAGCTCTTGG + Intergenic
973102924 4:46294749-46294771 TTTTTTTGAGAGACAGCTCTTGG + Intronic
973118441 4:46489040-46489062 TCCTTTTGAGAGGCAGCTCTTGG + Intergenic
973120981 4:46520901-46520923 TTCTTTTGAAATACAGCTCTTGG - Intergenic
973582797 4:52360823-52360845 TTTTACAAAGAGACAGCTCCAGG - Intergenic
974262372 4:59542272-59542294 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
974289569 4:59912739-59912761 TTCTTTTGAGAAATAGCTCTTGG + Intergenic
974372963 4:61041709-61041731 TCTTTTTAACAACCAGCTCTAGG + Intergenic
974560370 4:63509129-63509151 TTTTTCAAAAAAACAGCTCTTGG - Intergenic
974613419 4:64247631-64247653 TTTTTTAAAGATACATCTTTAGG - Intergenic
974644616 4:64674767-64674789 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
974728373 4:65826903-65826925 TATTTTTAAGAAAAAGCTTTTGG - Intergenic
974746915 4:66088908-66088930 TCATTTTGAGAGACAGCTCTTGG - Intergenic
974760657 4:66269458-66269480 TTTTTTAAAAAAACAGCTCCTGG - Intergenic
974864280 4:67561627-67561649 TTTATTTAAGCCACAGCACTAGG + Intronic
975021681 4:69498800-69498822 TTTTTTCAAGAAACAGCTCCTGG + Intronic
975024467 4:69531629-69531651 TCCTTTTGAGAGACAGCTCATGG + Intergenic
975051322 4:69868198-69868220 TCCTTTTGAGAGACAGATCTTGG + Intergenic
975386717 4:73767512-73767534 TTCTTTTGAGAGACAGCTTTTGG - Intergenic
975572046 4:75827705-75827727 TTTTTTTAAGAGATAGGGCCTGG - Intergenic
975614519 4:76233675-76233697 GTTCTTTAAGAGACAGGGCTAGG + Intronic
975937409 4:79598763-79598785 TTTCTTTAAGAGACACATCTTGG + Intergenic
975982616 4:80177280-80177302 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
976034206 4:80795825-80795847 CTTATTTGAGAGACAGATCTTGG - Intronic
976267625 4:83199476-83199498 TTTTTTTAAGAGACAGGGTCTGG + Intergenic
976278985 4:83308105-83308127 TTTTTTTAAGAGACAGGGTGTGG + Intronic
976425109 4:84894356-84894378 CTTTTTAAAAAGTCAGCTCTTGG + Intronic
977204715 4:94155681-94155703 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
977430766 4:96928209-96928231 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
977459968 4:97312675-97312697 TATTTTCATGAGGCAGCTCTTGG - Intronic
977466000 4:97383371-97383393 TCCTTTTGAGAGACAACTCTTGG + Intronic
977490072 4:97700074-97700096 TCCTTTTGAGGGACAGCTCTTGG - Intronic
977626277 4:99192657-99192679 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
977701732 4:100029890-100029912 TCCTTTTGAGTGACAGCTCTTGG - Intergenic
977833276 4:101618171-101618193 TCCTTTTGAAAGACAGCTCTTGG - Intronic
977847095 4:101779224-101779246 TCTTTTTGAGAAACAGTTCTTGG - Intronic
977930413 4:102743822-102743844 TCCTTTTGAGAGACAGCTCTTGG - Intronic
978433853 4:108661897-108661919 TTTTTTTAAGATTCTGCTTTTGG - Intronic
978461483 4:108958526-108958548 TTTTTTTAAAAAAAACCTCTAGG + Intronic
978772153 4:112467783-112467805 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
978865711 4:113507567-113507589 TATTTTTAAAAGACATCTATGGG - Intronic
978899076 4:113926821-113926843 TCCTTTTGAGGGACAGCTCTTGG - Intronic
978918653 4:114154536-114154558 CTCTTTTGAGAAACAGCTCTTGG + Intergenic
979164593 4:117511687-117511709 TTTTTTTAAGTAAATGCTCTAGG + Intergenic
979206962 4:118049429-118049451 TTTTTCTAAGAAACAACTCTTGG - Intronic
979373558 4:119917703-119917725 TTTTTTCAAAAAACAGCTCCTGG - Intergenic
979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG + Intergenic
979888568 4:126062176-126062198 TTCTTTTGAGAGATAGCTCTTGG - Intergenic
979898403 4:126189060-126189082 TCCTTTTGAGAGAAAGCTCTTGG - Intergenic
980059341 4:128111984-128112006 TTTTTTTAAGAGACAGAGGATGG - Intronic
980101579 4:128546722-128546744 TCTTTTTCAGAGGCATCTCTAGG + Intergenic
980262441 4:130468526-130468548 ATCTTTTGAGAGACAGCTCCTGG + Intergenic
980283004 4:130744744-130744766 TTTTTTGAAGAAACAACTCTTGG + Intergenic
980405892 4:132353794-132353816 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
980477599 4:133337839-133337861 TTTTATTAAGAAACAGCTCCTGG + Intergenic
980497527 4:133605365-133605387 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
980555823 4:134402802-134402824 TTTTTTGAAGAAACAGCTATTGG + Intergenic
980602159 4:135039517-135039539 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
980629522 4:135414283-135414305 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
981107165 4:140894118-140894140 TGTTCTTAAGAAACAGCACTTGG + Intronic
981428994 4:144639351-144639373 TTTTTCAAAGAACCAGCTCTTGG - Intergenic
981835002 4:149043942-149043964 TCCTGTTGAGAGACAGCTCTTGG + Intergenic
981873538 4:149515193-149515215 TTTTTTTGAGAGGCAGCTCTTGG + Intergenic
982168069 4:152633510-152633532 TCTTTTTAACAGAGAACTCTAGG - Intronic
982218254 4:153101446-153101468 TTTTTTTAAAAAAAAGCTTTTGG - Intergenic
982597776 4:157407029-157407051 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
982618097 4:157667514-157667536 TTTTTTTAAAAAAAAGCTATTGG + Intergenic
982623342 4:157732904-157732926 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
982835538 4:160116638-160116660 TCCTTTTGAGAGAGAGCTCTTGG + Intergenic
982847768 4:160274293-160274315 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
982995176 4:162335003-162335025 TTTTGTGAATAGACAGATCTGGG + Intergenic
983008185 4:162511639-162511661 AATATATAAGAGACAGCTCTTGG + Intergenic
983027389 4:162755292-162755314 TCCTTTTTAGAGACAGCTCTTGG + Intergenic
983185063 4:164691572-164691594 TCCTTTCGAGAGACAGCTCTTGG + Intergenic
983342024 4:166473691-166473713 TTTTTTTGATGGACAACTCTAGG - Intergenic
983365420 4:166780746-166780768 TTTTGTTAAGCTACAGCTTTAGG - Intronic
983582675 4:169324809-169324831 TTCTTTTAAGAGACAGCTCTTGG + Intergenic
983590209 4:169400901-169400923 TTTATTTAAGTAACATCTCTAGG - Intronic
983592118 4:169425561-169425583 TCTTTTTAAGAAATAGGTCTTGG + Intronic
983774632 4:171591991-171592013 TTTTTTCAAAAAACAGCTCCTGG + Intergenic
983909193 4:173217606-173217628 TGTTTTTAAGATTCAACTCTTGG + Intronic
984060285 4:174982027-174982049 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
984289112 4:177770583-177770605 TTTTTATATAAGATAGCTCTAGG - Intronic
984306973 4:178005855-178005877 TCTTTGGAAGAAACAGCTCTTGG - Intergenic
984871442 4:184329027-184329049 ATTTTACAAAAGACAGCTCTAGG + Intergenic
984973817 4:185212276-185212298 TTTTTTTAAGAGGCAGGGTTAGG - Intronic
985277259 4:188250057-188250079 TTTTTTAAAGAGATAGTTATTGG - Intergenic
985331856 4:188845963-188845985 TTTTTTTAACAGTCTTCTCTCGG - Intergenic
986037034 5:3950440-3950462 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
986087108 5:4462715-4462737 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
986096818 5:4564653-4564675 ATTTCTTATGAGACAGATCTGGG - Intergenic
986727407 5:10609526-10609548 TTTTTTTTGGAGACAGGTCTTGG - Intronic
986742918 5:10719503-10719525 TCCTTTTGAGAGACAGCTCTTGG + Intronic
986817527 5:11429050-11429072 TTGATTTAAGAGAAAGCTATAGG + Intronic
986938332 5:12918753-12918775 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
987072253 5:14349696-14349718 TTTTTTTAAAAGACGGATTTTGG - Intronic
987468190 5:18296987-18297009 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
987504386 5:18749851-18749873 TCCTTTTGAGAGACAACTCTTGG + Intergenic
987578342 5:19758314-19758336 TCCTTTTGAGAGGCAGCTCTTGG - Intronic
987657138 5:20821654-20821676 TCTTTTTGAGAGACAGGTCTTGG - Intergenic
987967646 5:24896338-24896360 TCTTTTTGAGAGATAGGTCTTGG + Intergenic
988056569 5:26105270-26105292 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
988079832 5:26401422-26401444 TCCTTTTGAGAGACAACTCTTGG - Intergenic
988107757 5:26772544-26772566 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
988160826 5:27516873-27516895 TCCTTTTGAGAGACAGATCTAGG - Intergenic
988188774 5:27901234-27901256 TCCTTTTAAGAGACAGCTCTTGG + Intergenic
988193999 5:27977406-27977428 TTTTTTGAAAAAACAACTCTTGG + Intergenic
988228768 5:28448124-28448146 TCATTTCAAGAGACAGCTCATGG + Intergenic
988450493 5:31337939-31337961 TTTTTTTAAGCATCAGTTCTTGG + Intergenic
988562129 5:32290845-32290867 TCCTTTTGAAAGACAGCTCTTGG + Intronic
988766413 5:34382294-34382316 TCTTTTTGAGAGACAGGTCTTGG + Intergenic
988824842 5:34925935-34925957 TTTTTTGAAGTGACAGATCAGGG - Exonic
988952480 5:36277353-36277375 TTTATTTAAAATACAGCTCTAGG - Intronic
989045207 5:37267593-37267615 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
989306200 5:39959679-39959701 TTTTATCATGAGACAGCGCTAGG - Intergenic
989457642 5:41661770-41661792 TTCTTTTGAGGGACAGCTCTTGG - Intergenic
989486385 5:41996361-41996383 TCCTTTTGAGTGACAGCTCTTGG - Intergenic
989679027 5:44007551-44007573 TGCTTTTGAGAAACAGCTCTTGG - Intergenic
989792070 5:45417170-45417192 TATTTTCAAGAGATAGCTCACGG + Intronic
990016313 5:51066585-51066607 TTTTTTTAAAAAACAACTCCTGG - Intergenic
990163423 5:52968698-52968720 CTTTTCAAAGAAACAGCTCTTGG + Intergenic
990257895 5:53990219-53990241 TTTTTTTTAGAGACAGGGCCTGG - Intronic
990380896 5:55221277-55221299 TTTTTTTAAAACAAAGCACTTGG + Intronic
990594383 5:57298629-57298651 ATGTTTTAAAAGACAGCGCTGGG + Intergenic
990808318 5:59692231-59692253 AGTTTTAAAGAGAGAGCTCTTGG + Intronic
990899199 5:60732048-60732070 TCTTTTCAAAAAACAGCTCTGGG - Intergenic
991013808 5:61910902-61910924 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
991033544 5:62105920-62105942 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
991330739 5:65489686-65489708 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
991501820 5:67284394-67284416 TTTTGTAAAGAGCCAGCTCTTGG + Intergenic
991579354 5:68138004-68138026 TTCTTTTTAGAGCCAGCTCTCGG + Intergenic
991713892 5:69433759-69433781 TTTTTTTAAAAGCCAGATTTTGG - Intronic
991946145 5:71900139-71900161 TTTTTTTGAGAGACAGCTGTTGG + Intergenic
992172123 5:74113212-74113234 GTATTTTAAGTGACAGCTCTTGG + Intergenic
992332975 5:75736692-75736714 TTTTTTCTAGACACAGCTTTTGG + Intergenic
992374973 5:76179966-76179988 ATTTTTTAAGAGAGGGATCTTGG + Intronic
992581242 5:78179148-78179170 TTTTTTTAAATGACTGATCTTGG - Intronic
992620549 5:78588180-78588202 TTTGTTTAAGAGACAGCATCTGG + Intronic
993231902 5:85247535-85247557 TCCTTTTAAGAGACAGCTCTTGG - Intergenic
993296855 5:86151732-86151754 TCTTTTTAAGAAACAACTTTTGG - Intergenic
993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG + Intergenic
993412582 5:87591814-87591836 TTCTTTTGAGAGGAAGCTCTTGG - Intergenic
993741410 5:91545261-91545283 TTTTTTTAACAACCAGATCTGGG + Intergenic
994251613 5:97542449-97542471 TTTTTTTAAATGTCAGTTCTTGG - Intergenic
994291375 5:98031973-98031995 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
994855436 5:105113586-105113608 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
994984421 5:106915731-106915753 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
995506291 5:112863674-112863696 TTTTTTTAAGAGACAGGGTCTGG + Intronic
995621340 5:114029503-114029525 TTTACTTAAGAAACAGCTCTTGG + Intergenic
995761684 5:115568425-115568447 TTTTTTTAATATATAGCTGTTGG - Intergenic
995776287 5:115727681-115727703 TCTTCTTGAGAGACAGCTCTTGG - Intergenic
995915787 5:117243046-117243068 ATTTCTTAAGAGACAAGTCTAGG - Intergenic
996392203 5:122973787-122973809 TCCTTTTGAGAGACAGCTCTTGG - Intronic
996603478 5:125293365-125293387 TTTGATTAAGAGAATGCTCTTGG + Intergenic
996818893 5:127603503-127603525 TTTTTTTGAGAGACCACTCAAGG - Intergenic
996825562 5:127677833-127677855 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
997176138 5:131779897-131779919 TTTTTTTAATAAAAAGCTTTAGG + Intronic
997324573 5:133009301-133009323 TTTTTTTAAGAGACAGAATCAGG - Intronic
997406180 5:133648684-133648706 ATTTTTTAAAAGTCAGCACTGGG - Intergenic
998058572 5:139100677-139100699 TTTTTTGAAGACAGAGCTGTTGG + Intronic
998290337 5:140908553-140908575 TCCTTTTGAGAGACAGCTCTTGG - Intronic
998961670 5:147494431-147494453 CTTTTTGAAGAGCCAGCTTTTGG - Intronic
999093733 5:148959320-148959342 TTTATTTAAGAAATAGTTCTGGG - Intronic
999351384 5:150874843-150874865 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1000108508 5:158084150-158084172 TATTTTTAAGACATAGCTCATGG - Intergenic
1000223246 5:159234250-159234272 TCCTTTTGAGACACAGCTCTTGG - Intergenic
1000416972 5:160993900-160993922 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1000588767 5:163132420-163132442 TTTTTTCATGAGACAACTTTAGG + Intergenic
1000610522 5:163368567-163368589 CTTTTTTAACAACCAGCTCTGGG - Intergenic
1000621619 5:163492940-163492962 CTCTTTTGAGAAACAGCTCTGGG - Intergenic
1001173594 5:169444641-169444663 TCCTTTTGAAAGACAGCTCTTGG + Intergenic
1001188495 5:169602229-169602251 TTTTATTAAGACAAAGCCCTTGG - Intronic
1001340417 5:170838454-170838476 ATTTTTTAAAAGACAGCTTTTGG - Intergenic
1002719413 5:181248636-181248658 TTTCTTTAAGAGTCTGATCTCGG + Intergenic
1002719417 5:181248674-181248696 TTTCTTTAAGAGTCTGATCTCGG + Intergenic
1002719421 5:181248712-181248734 TTTCTTTAAGAGTCTGATCTCGG + Intergenic
1003065092 6:2897709-2897731 TCTTTTAAAGAACCAGCTCTTGG - Intronic
1003221639 6:4165688-4165710 TTTTTTTTATAGACATCCCTGGG + Intergenic
1003695899 6:8406141-8406163 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1003758606 6:9150080-9150102 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1003828009 6:9974157-9974179 TCTTGTTAAGATACAGATCTTGG + Intronic
1004340899 6:14806593-14806615 TGTCTTTAAGATCCAGCTCTGGG - Intergenic
1004729300 6:18342275-18342297 TTTTTTTTTGAGACAACTCAAGG - Intergenic
1004824289 6:19403237-19403259 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1004873065 6:19927072-19927094 TTTTTTTAGCAACCAGCTCTAGG + Intergenic
1005185167 6:23157071-23157093 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
1006001555 6:30969074-30969096 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1006411155 6:33874280-33874302 TGTTCTTAAGACACTGCTCTCGG + Intergenic
1006784719 6:36658483-36658505 TTATTTTAAGACACAGATTTTGG + Intergenic
1007300023 6:40860787-40860809 TTGTTTTAACAGCCAGCTCTGGG - Intergenic
1008266923 6:49439290-49439312 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1008496362 6:52137937-52137959 TTTTTTTAAGTAACAGTTTTGGG + Intergenic
1008653786 6:53590258-53590280 TTTTTTTTTGAGACAGAGCTGGG + Intronic
1009298198 6:61981435-61981457 TTTTTTTAAGTGAGAGGACTTGG - Intronic
1009390112 6:63135079-63135101 TCTTTTTGAGAGACAGCTTTTGG - Intergenic
1009660696 6:66606923-66606945 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1009851926 6:69208959-69208981 TCCTTTTGAGAGACAACTCTTGG - Intronic
1010252683 6:73724624-73724646 TTTTTTTTTGAGACAGGTCTTGG + Intronic
1010323576 6:74540488-74540510 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1010580754 6:77593906-77593928 CCCTTTTGAGAGACAGCTCTTGG - Intergenic
1010818631 6:80388399-80388421 TCCTTTTGAGAGACAGCTCCTGG + Intergenic
1010854104 6:80815418-80815440 TCCTTTTTAGAGACATCTCTTGG - Intergenic
1010938246 6:81886418-81886440 TGCTTTTGAGAGACAGCTCTTGG - Intergenic
1011069100 6:83361664-83361686 TCCTTTTGAGAGACAGCTCCTGG + Intronic
1011273649 6:85605434-85605456 TTTTTTTAAGAGATAACGGTTGG - Intronic
1011359464 6:86507476-86507498 GTTTTTTAAGAGACATCATTAGG + Intergenic
1011414276 6:87101320-87101342 TCTTTTTAACAACCAGCTCTGGG - Intergenic
1011528731 6:88296559-88296581 TTTTTCTTAATGACAGCTCTGGG + Intergenic
1011732426 6:90279209-90279231 TTTTTTTAAGAGCAAGATTTAGG - Intronic
1012571894 6:100739868-100739890 TTTTTTAAAAAAACAGCTCCTGG + Intronic
1012632256 6:101485945-101485967 CTTTTTTAAGGGACAGCTGGTGG + Intronic
1012717521 6:102695558-102695580 GTTTTTTAAGAGGCATCACTAGG + Intergenic
1012730460 6:102874318-102874340 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1012920795 6:105219546-105219568 TCATTTTGAGAGACAGCTCTTGG - Intergenic
1013103362 6:107006006-107006028 TTTTTTTAAGAGACAGGGTCTGG - Intergenic
1013301275 6:108807059-108807081 TATTTTTAAAAGAAAGCTTTGGG + Intergenic
1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1013917494 6:115358848-115358870 TTTTTTTGTGAGACAGCTTCTGG - Intergenic
1014363398 6:120508355-120508377 TCCTTTTGAGAGAGAGCTCTTGG - Intergenic
1014388228 6:120827608-120827630 TTTTTCAAAGAAACAGCTTTTGG + Intergenic
1014416986 6:121195388-121195410 TACTTCTGAGAGACAGCTCTTGG + Intronic
1014534198 6:122596623-122596645 TCCTTTTGAGAGAGAGCTCTTGG - Intronic
1014596884 6:123354945-123354967 TTTTTCTAAGAGACAGTAGTAGG - Intronic
1014895654 6:126896573-126896595 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1015443286 6:133272566-133272588 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1015475748 6:133657490-133657512 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1015634886 6:135265227-135265249 TTTTTTTTTGAGACGGATCTCGG - Intergenic
1015657311 6:135533372-135533394 CTTTTTAAAGAGAAAGATCTTGG + Intergenic
1015862092 6:137691840-137691862 TCCTTTTAAGAGACAGCTTTTGG + Intergenic
1015974423 6:138774723-138774745 TTATTTTAAGCGACAGCAATGGG + Intronic
1016028834 6:139316689-139316711 ATTTTTTAAAAAACAGCTTTTGG + Intergenic
1016119916 6:140332693-140332715 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
1016144289 6:140649401-140649423 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1016147331 6:140692717-140692739 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1016419615 6:143870683-143870705 TTCTTTTGAGAGACAGCTCTTGG - Intronic
1016440137 6:144074715-144074737 TTTTTTTTTGAGACAGAGCTTGG - Intergenic
1016576259 6:145572588-145572610 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1016594550 6:145784879-145784901 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1017044070 6:150330855-150330877 TCGTTTTGAGAAACAGCTCTTGG - Intergenic
1017173214 6:151477311-151477333 TTTTTTTTTGAGACAGGTCCTGG + Intergenic
1017326746 6:153149850-153149872 CTTTTTAAACAGCCAGCTCTTGG + Intergenic
1017343511 6:153353782-153353804 GTTCTTTAGGAGACAGGTCTAGG - Intergenic
1017358039 6:153533258-153533280 TTCTTTGAAGAACCAGCTCTTGG + Intergenic
1017380610 6:153824033-153824055 CTTTTTTCAGAGCCAGCTTTAGG - Intergenic
1017388457 6:153912208-153912230 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1017502590 6:155039254-155039276 TCTTTTTAAGAGACAGGTTCAGG - Intronic
1017637798 6:156460040-156460062 TTTGTTTAGGAGAGAGATCTGGG - Intergenic
1017648744 6:156562500-156562522 TTCCTTTAAGAGAGAGCTCCAGG - Intergenic
1017754210 6:157515816-157515838 TGGTGTTAAGAGACAGCTGTGGG - Intronic
1018122929 6:160655224-160655246 TCCTTTTGAGAGACAGCTATTGG - Intronic
1018596493 6:165486700-165486722 TTTTTCTAAAAGACATCTCTGGG - Intronic
1018599885 6:165527525-165527547 TCCTTTTGAGAGACAGCTATTGG + Intronic
1018803793 6:167242992-167243014 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1019024390 6:168945790-168945812 TTTTTTGAAGAAACAGCTTTAGG + Intergenic
1019914093 7:4120914-4120936 TTTTTTTAAAAGAGTGTTCTTGG - Intronic
1019962345 7:4471504-4471526 TTTGTTTTCGAGACAGATCTGGG + Intergenic
1020058597 7:5135716-5135738 TTTTTTAAAGTGACTGATCTCGG - Intergenic
1020396716 7:7725513-7725535 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1020710348 7:11597624-11597646 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1021309411 7:19074287-19074309 TTTTTTTAAGAAATTTCTCTTGG - Intronic
1021633922 7:22672629-22672651 ATTTTTAAAAAGAGAGCTCTTGG + Intergenic
1021988808 7:26122921-26122943 TCCTTTTGAGTGACAGCTCTTGG + Intergenic
1021994481 7:26166464-26166486 TTTATTTCACAGCCAGCTCTTGG - Intronic
1022078885 7:27000327-27000349 TCTTTTTGAGACACAGCTATTGG + Intergenic
1022409628 7:30128898-30128920 TCTTTTTAACAACCAGCTCTCGG + Intronic
1022689419 7:32632248-32632270 TCATTTTAACAGACAGCTCCTGG + Intergenic
1022900059 7:34799336-34799358 CTTTTTAAAGAAACAGCTTTTGG - Intronic
1022916996 7:34966599-34966621 TCATTTTAACAGACAGCTCCTGG + Intronic
1023107366 7:36775457-36775479 TCTTTTTAACAACCAGCTCTTGG - Intergenic
1023124431 7:36941360-36941382 TGTTTTTCAGAGTAAGCTCTGGG + Intronic
1023525987 7:41103762-41103784 TTTTGTTCTGAGACATCTCTAGG - Intergenic
1023936023 7:44740277-44740299 TCTTATGAAGAGACAGCTGTTGG + Intergenic
1024040536 7:45550143-45550165 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1024322170 7:48082236-48082258 TTTTCTGATGAGGCAGCTCTGGG - Intergenic
1024374868 7:48625737-48625759 TTTGATAAAGTGACAGCTCTGGG - Intronic
1024706785 7:51970105-51970127 TTTTTTAATAAGACAACTCTTGG + Intergenic
1024744206 7:52388442-52388464 CCTTTTTGAGAGACAGCTCTTGG + Intergenic
1024789676 7:52950268-52950290 CTTTTCTAAGAAAGAGCTCTTGG - Intergenic
1024866102 7:53906342-53906364 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1025016688 7:55444757-55444779 TTTTGTTAAGAGAAAATTCTGGG - Intronic
1025215201 7:57050578-57050600 TTTTTTTTTAAGACAGGTCTTGG + Intergenic
1025237121 7:57242105-57242127 TTTTTTTAAGAAACATGGCTGGG - Intergenic
1025656747 7:63526252-63526274 TTTTTTTTTAAGACAGGTCTTGG - Intergenic
1026022007 7:66715753-66715775 TTTTTTTTAGAGATGGGTCTCGG + Intronic
1026073689 7:67145942-67145964 TTTTTTTTAGAGACAGAGTTTGG + Intronic
1026590972 7:71695263-71695285 TTTCTTGCAGAGACAGTTCTAGG - Intronic
1026668999 7:72370746-72370768 TCTTTCAAAGAGAGAGCTCTTGG + Intronic
1026886363 7:73950064-73950086 TTTTTTTTAGAGATGGGTCTCGG + Intergenic
1027007569 7:74708382-74708404 TTTTTTTAAGGAACAATTCTAGG + Intronic
1027176540 7:75907494-75907516 TTTTTTTCAGAGACAGAGTTTGG + Intronic
1027287429 7:76661555-76661577 TAATTTTCAGAGACATCTCTAGG + Intergenic
1027397444 7:77770667-77770689 TTTTTTTAAGAGATAGGTTCTGG - Intronic
1027677046 7:81172882-81172904 AGTTTTAAAGAGAGAGCTCTTGG - Intergenic
1027685796 7:81277953-81277975 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1027790421 7:82633842-82633864 TTTTTTTCAGAGATGGCCCTGGG - Intergenic
1028141734 7:87281982-87282004 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028237819 7:88382819-88382841 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028361207 7:89968837-89968859 TTTTTTTAACAGACAGTTATGGG - Intergenic
1028781304 7:94739983-94740005 TTTTTTTAAGAGACACGTTCAGG + Intergenic
1028788007 7:94818772-94818794 TTTTTTAAAAAACCAGCTCTTGG + Intergenic
1028789104 7:94833389-94833411 ATTTTTAAAGAACCAGCTCTTGG + Intergenic
1028809780 7:95071481-95071503 TTTTTTTATGTGGCAGTTCTAGG + Intronic
1028935012 7:96455061-96455083 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028954276 7:96671945-96671967 TTTTTATAAGAGAGATTTCTAGG - Intronic
1030254229 7:107489790-107489812 TTTTTTTAAAAAAAATCTCTTGG - Intronic
1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG + Intergenic
1030403528 7:109082795-109082817 TTTTTTCAAAAAACAGCTCCTGG + Intergenic
1030700781 7:112637961-112637983 TTTTTTTAAAAGATAACTTTTGG - Intergenic
1030726075 7:112925781-112925803 TTTTTTTTTGAGACAGAGCTTGG - Intronic
1030931289 7:115525685-115525707 GCCTTTTGAGAGACAGCTCTTGG - Intergenic
1031047978 7:116914757-116914779 TTTTTTTAAAAGATAGCTTCAGG - Intronic
1031236825 7:119188013-119188035 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1031272772 7:119674028-119674050 TTATTTAAACAGTCAGCTCTGGG - Intergenic
1031395330 7:121267037-121267059 TTTTTTTAAGATAGAGTTTTAGG - Intronic
1031474447 7:122205355-122205377 TTCTTTTGAGAGACAGACCTTGG - Intergenic
1031544808 7:123037785-123037807 TTATTTTAAGAGGGAGCTCTTGG - Intergenic
1031628763 7:124021115-124021137 TTTTTTTTAGAAATAACTCTTGG + Intergenic
1031676557 7:124618362-124618384 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1031761418 7:125717115-125717137 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
1032153105 7:129446960-129446982 TACTTTTGAGAGACAGCTCTTGG - Intronic
1032189305 7:129754449-129754471 TTTTTTTAAGAGACAGGGTCTGG - Intronic
1032316734 7:130845044-130845066 TTTTTTTAAGAGACAGGGTCTGG + Intergenic
1032414299 7:131724644-131724666 TTTTGTTTAGAGACAGGTTTTGG + Intergenic
1032836758 7:135682136-135682158 TTTTTTTAAGGAACAGCTCATGG + Intronic
1032923472 7:136576118-136576140 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1033076256 7:138253043-138253065 TCCTTTTGAGAGGCAGCTCTTGG + Intergenic
1033664971 7:143432001-143432023 ATTTTTTAAAAGAAAGTTCTTGG - Intergenic
1033955008 7:146836250-146836272 TTTTTTTAAGAGATTAATCTTGG + Intronic
1034032932 7:147787556-147787578 TTTTGTTAAAGTACAGCTCTAGG - Intronic
1035027296 7:155834327-155834349 TTTTTTTAAGTGACAGCTCATGG - Intergenic
1035339258 7:158149825-158149847 TTTTTTCAAGAGACATCACTTGG - Intronic
1035599188 8:886308-886330 TTTTTTCAAAAAACAGCTCCTGG + Intergenic
1035753200 8:2009853-2009875 TTTTTTTGGGATGCAGCTCTGGG - Intergenic
1037364594 8:18108272-18108294 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1037437383 8:18877397-18877419 TCTTTTCAACAGATAGCTCTGGG - Intronic
1037442913 8:18935496-18935518 TTTTTTTAAGAGACAGGGTCTGG - Intronic
1037953616 8:23036099-23036121 TCCTTTTGAGAAACAGCTCTTGG + Intronic
1038227610 8:25671106-25671128 TTTTTTTAAGAGACAGAAGGAGG - Intergenic
1038377536 8:27057495-27057517 TTTTTTTAAGAAACAGCATCTGG - Intergenic
1040540947 8:48354931-48354953 TTTTTCAAAAAGCCAGCTCTTGG - Intergenic
1040605303 8:48925676-48925698 GTATTTTAAGCGACAGCTCAGGG + Intergenic
1040911945 8:52528415-52528437 TGCTTTTGAGAGACAGCTCTTGG + Intergenic
1041817152 8:61986940-61986962 TTTTTTTAAGTTACAGATCGTGG + Intergenic
1041913597 8:63116469-63116491 TATTTTTAAAAGATACCTCTCGG + Intergenic
1041934552 8:63321327-63321349 TCCTTTTGAGAGACAGCTCTCGG + Intergenic
1041986181 8:63924470-63924492 TCTTTTTGAGAGATAGCTCTTGG + Intergenic
1042001063 8:64123999-64124021 TCCTTTTGGGAGACAGCTCTTGG - Intergenic
1042342419 8:67694348-67694370 TCCTTCTGAGAGACAGCTCTTGG + Intronic
1042359743 8:67868902-67868924 TTTTTTCAAGAGGCAGCATTTGG + Intergenic
1042417898 8:68546049-68546071 CATTTTTAAGTGACTGCTCTTGG - Intronic
1043147345 8:76674695-76674717 ATATTTTAAGAGACAACTCGAGG - Intergenic
1043270260 8:78324480-78324502 TTTTTTTAGGACACATTTCTAGG - Intergenic
1043612286 8:82079932-82079954 CTTTTTAAAGAGCCAGCTTTTGG + Intergenic
1044024413 8:87150823-87150845 TATTTCAAAGAGATAGCTCTTGG + Intronic
1044202388 8:89452485-89452507 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1044241037 8:89888884-89888906 TTTTTTATAGAGACAGGGCTGGG - Intergenic
1044308239 8:90662805-90662827 CTTTTTAAAGAAACAGCTTTTGG + Intronic
1044530042 8:93297239-93297261 TTTTTCTAAGCCACAGCACTTGG - Intergenic
1044633156 8:94298409-94298431 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
1044714760 8:95090092-95090114 TTTTCTTAAGAGACACCTTAAGG + Intronic
1044911988 8:97069456-97069478 TTTTTTTTAGAGACAGATGGGGG - Intronic
1045345489 8:101289965-101289987 TTTTTTAATGAAAAAGCTCTTGG + Intergenic
1045381636 8:101633589-101633611 GTGTTTTAAGAAACAGCTATAGG - Intronic
1045479527 8:102581066-102581088 TTTTTTTAAGAGACAGGGTCTGG + Intergenic
1046128675 8:109941605-109941627 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1046197557 8:110884220-110884242 TCATTTTGAGGGACAGCTCTTGG + Intergenic
1046417639 8:113937797-113937819 TCCTTTTGAGAGACAGGTCTTGG - Intergenic
1046585786 8:116147722-116147744 TTTTTTTAAGAGACAGCTCTTGG - Intergenic
1046646698 8:116793487-116793509 TTTTTTTAAAATACATGTCTTGG - Intronic
1046862821 8:119113709-119113731 TTTCTTTAAGACTCTGCTCTTGG - Intergenic
1047300211 8:123607577-123607599 TTTTTCCAAAAAACAGCTCTTGG - Intergenic
1048096466 8:131300640-131300662 TTTTCCAAAGTGACAGCTCTTGG + Intergenic
1048184651 8:132228743-132228765 TTTTTTCAAGAGTCAGCTGAGGG - Intronic
1048313147 8:133341827-133341849 TTTTTAGAAGAAACAGCACTGGG + Intergenic
1048404921 8:134109578-134109600 TTTTTTTAAGATACAGGTAAGGG + Intergenic
1048405146 8:134111423-134111445 TTTTTCTAAGAGATAGCTGGGGG - Intergenic
1048853365 8:138665090-138665112 TTTTATTATTAGACAGCTCTGGG - Intronic
1049128452 8:140813866-140813888 TTTTTTAAAAAAACAACTCTTGG - Intronic
1049224411 8:141442904-141442926 TTTTTTTATGACACAGCTTGGGG - Intergenic
1049588820 8:143445685-143445707 TTTTTTTAAGAGACAGAGACAGG - Intronic
1049947577 9:612274-612296 TTTTTTTAATAGCCAGTTATTGG + Intronic
1050199143 9:3124033-3124055 TTTTTTTAAGAGTCAGGACCAGG - Intergenic
1050440907 9:5662771-5662793 TTTTTTAAATAACCAGCTCTTGG + Intronic
1050482673 9:6102600-6102622 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1050499058 9:6275706-6275728 TTTTTTTAAGAGTCTCTTCTAGG - Intergenic
1050564033 9:6863841-6863863 TCTTTTTAACAGCCAGCTCATGG + Intronic
1050588527 9:7138806-7138828 TTTTTTTTAGAGACAGGGTTTGG - Intergenic
1050900708 9:10945340-10945362 TTTTTTTAAAAAACAACTTTGGG - Intergenic
1050934407 9:11376791-11376813 TTCTTTCTAGAGACAGTTCTTGG - Intergenic
1051085421 9:13343060-13343082 CTTTTTTAAAAAACAGCTCCTGG + Intergenic
1051653995 9:19360802-19360824 TTTTCTTAAGGGATAGCTCCTGG + Intronic
1052170231 9:25385650-25385672 TTTTTTTAAAATAGAGCTTTAGG - Intergenic
1052227588 9:26108373-26108395 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1052368649 9:27640833-27640855 TCCTTTTGAGAGACAGCCCTTGG + Intergenic
1052577241 9:30305981-30306003 TTTTTTTAAGAGAAAGAACTCGG + Intergenic
1054966585 9:71034759-71034781 TTTTTTTTAGAGAGAGATGTTGG + Intronic
1055163675 9:73163789-73163811 TTTTTTTAACAAACAATTCTTGG - Intronic
1055210601 9:73786240-73786262 TTTTTTAAAAAAACAGCTCCTGG - Intergenic
1055390655 9:75818684-75818706 CTTTTTTAAAAAACAGCTCCTGG + Intergenic
1055692618 9:78848827-78848849 TTTTTTCAAGAACCAGCTCTTGG + Intergenic
1056156665 9:83845206-83845228 TCCTTTTAAGAGACAGCTCTTGG + Intronic
1056314235 9:85372948-85372970 TTCTTTTCAGAGACAGCTCTTGG - Intergenic
1056353873 9:85778321-85778343 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1056558478 9:87709526-87709548 TTTTTTTGAGAGAGAGGGCTTGG + Intergenic
1056809739 9:89754932-89754954 GCTTTAGAAGAGACAGCTCTGGG - Intergenic
1057280772 9:93710002-93710024 TTTTTTTAAGAGAGAAATCTTGG - Intergenic
1057715837 9:97494886-97494908 TTTTTTGTAGAGACAGGGCTGGG + Intronic
1058019895 9:100076077-100076099 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1058199771 9:102025192-102025214 TTTTTTCAAAAAACAGCTCCTGG + Intergenic
1058246258 9:102629375-102629397 TTTTTTGAAGGAACAACTCTTGG + Intergenic
1058266288 9:102902942-102902964 TCTTTTTAAAAAACAGCTCCTGG - Intergenic
1058544167 9:106042753-106042775 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1058575041 9:106391926-106391948 TTATTTTAAGAAAAAGCACTAGG + Intergenic
1058591367 9:106568671-106568693 TTTTTCAAAAAAACAGCTCTTGG - Intergenic
1059084557 9:111286218-111286240 TTTTTTTTAGAGACAGGGCATGG + Intergenic
1059342641 9:113607532-113607554 TTTTGTTAAAAAACAGCTTTAGG + Intergenic
1059370877 9:113833595-113833617 TGTTTTTGACAAACAGCTCTGGG - Intergenic
1059455163 9:114395722-114395744 TTTTTTTTAAAGACAGCTGCAGG - Intergenic
1059789197 9:117621601-117621623 TTTTTTTAAGAGAAAACTGTGGG + Intergenic
1059956795 9:119524460-119524482 TTTTTTGAAGAGAAAGCCCTTGG + Intergenic
1059971194 9:119669986-119670008 TTTTTTTAAGAGATAGCTGCTGG - Intergenic
1060165127 9:121406774-121406796 TTTTTTTAAGTGGTTGCTCTAGG - Intergenic
1060165172 9:121407265-121407287 TTTTTTTAAAAAACTGCACTAGG - Intergenic
1060178779 9:121517314-121517336 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1060251888 9:121993337-121993359 TTTTTTTAAGTCATAGCTTTTGG + Intronic
1060805144 9:126570691-126570713 TTTTTTTGAAAGATTGCTCTTGG - Intergenic
1061349779 9:130054910-130054932 TTTTTTGTAGAGACAGGTTTGGG - Intronic
1061358384 9:130123665-130123687 TTTTTTTAAGAGACAGGGAGGGG + Intronic
1186034784 X:5410355-5410377 TTTTTTTAAGAGACAGGGTCTGG + Intergenic
1186093548 X:6075664-6075686 TCTTTTAAACAGTCAGCTCTTGG - Intronic
1186279494 X:7977115-7977137 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1186356029 X:8791166-8791188 TTTTTTTTTGAAACAGCTTTTGG - Exonic
1186377779 X:9025371-9025393 TTTTTTTTTGAAACAGCTTTTGG - Exonic
1186384095 X:9091765-9091787 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1186913074 X:14190559-14190581 TTTTTTTAAAAACCAGCTCCTGG + Intergenic
1187157656 X:16736154-16736176 TTTTTTTAACAGACAATTATAGG + Exonic
1187166072 X:16805001-16805023 TTTTTTTGAGAGACAGAGCCTGG + Intronic
1187238622 X:17492068-17492090 CTTTTTAAAAAAACAGCTCTTGG + Intronic
1187460370 X:19481290-19481312 TTTTTTTAAGAAACAGTGCTGGG + Intronic
1187604864 X:20871859-20871881 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1187635908 X:21228000-21228022 TTTTTTTAAAGGACAGTTCTGGG - Intergenic
1188513357 X:30959980-30960002 ATCTTGTAAGAGACAGCACTAGG + Intronic
1188680047 X:32992893-32992915 TTTTTTTTTGAGACAGAGCTTGG - Intronic
1188793870 X:34438892-34438914 TTTTTTCAAAAAACAGCTCCTGG - Intergenic
1189048238 X:37616289-37616311 TTATTTTAAGAGGCACTTCTTGG + Intronic
1189053148 X:37667911-37667933 TCTTTTTAACAGTCATCTCTTGG + Intronic
1189154885 X:38746725-38746747 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
1189996923 X:46647665-46647687 TTTTCATAAGCCACAGCTCTAGG - Intronic
1190255272 X:48757800-48757822 TCCTTTTGAGAAACAGCTCTTGG + Intergenic
1190601539 X:52097838-52097860 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1191034656 X:56011666-56011688 TTTTTTCAAGAAACTGCTCCTGG - Intergenic
1191095707 X:56671178-56671200 TTCTTTTAAAAGACAGTTCTTGG - Intergenic
1191134035 X:57044491-57044513 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1191630039 X:63312592-63312614 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1191631293 X:63324875-63324897 TCATTTTGAGAGACAGCTTTTGG + Intergenic
1191638746 X:63407526-63407548 TCTTTTTAACAAACAGTTCTTGG + Intergenic
1191651254 X:63540220-63540242 TTTTTCAAAGAACCAGCTCTTGG - Intergenic
1191651431 X:63542283-63542305 TTTTTTCAAAAGACAGCTCCTGG - Intergenic
1191658806 X:63629810-63629832 TCCTTTTTAAAGACAGCTCTTGG - Intergenic
1191815345 X:65238521-65238543 TTTTTTCAAAATACAGCACTGGG + Intergenic
1191932925 X:66394159-66394181 TTTTTTTGAGAGACAGCTTTTGG + Intergenic
1191941262 X:66483869-66483891 TCTTTTTGAGAGACAGTCCTTGG - Intergenic
1191946352 X:66539007-66539029 TCCTTTTGAGAGACTGCTCTTGG + Intergenic
1192297712 X:69868020-69868042 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1192328513 X:70154431-70154453 ATTTTTTAAGTGGCTGCTCTAGG - Intronic
1192673253 X:73168421-73168443 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
1192898702 X:75471905-75471927 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1192996191 X:76515573-76515595 TCCTTTTCAGAAACAGCTCTTGG + Intergenic
1193053489 X:77125763-77125785 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1193361419 X:80583817-80583839 TTTTTTGAAAAAACAGCTCCTGG + Intergenic
1193447155 X:81618766-81618788 TTCCTTTGAGAGACAGCTCTTGG + Intergenic
1193573669 X:83174936-83174958 TCCTTTTTAGAGACAGCTCTTGG - Intergenic
1193595145 X:83436476-83436498 TTTTTTTAAAAACCAGCTCCTGG + Intergenic
1193672072 X:84399273-84399295 TTTTTTCAAAAAACAGCTCCTGG - Intronic
1193876041 X:86863913-86863935 TTGTTTTGAGAAACAGCTTTTGG + Intergenic
1193957283 X:87878205-87878227 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1194179592 X:90695940-90695962 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1194210277 X:91062349-91062371 TCCTTTTGAGAGACTGCTCTTGG + Intergenic
1194431752 X:93816341-93816363 GTTTTTTAAGAGACATTACTAGG - Intergenic
1194443548 X:93961098-93961120 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1194513419 X:94822257-94822279 TCCATTTGAGAGACAGCTCTTGG - Intergenic
1194532388 X:95067898-95067920 GTTTTTAAAGAGCCAGCTCATGG - Intergenic
1194589026 X:95773550-95773572 TATTTTTGAGAAACAACTCTGGG + Intergenic
1194604390 X:95961973-95961995 CTCTTTTGAGAGACAGCTTTTGG - Intergenic
1194649421 X:96497867-96497889 TCTTTTTAAGAAATAGTTCTTGG + Intergenic
1194698912 X:97090328-97090350 TTTTTTTGAGAAAGAGCTCTGGG + Intronic
1194830354 X:98616206-98616228 TTTTTCAAAAAGACAGCTCCTGG + Intergenic
1194849247 X:98852179-98852201 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1195050164 X:101089564-101089586 TTTTTTTTAGAGACAGCCCCTGG - Intronic
1195134951 X:101895995-101896017 TTTTTTCAACAGACAGCTGCTGG + Intronic
1195228468 X:102822266-102822288 TTCTTTTGAGAAACAGCTCTTGG + Intergenic
1195685529 X:107581449-107581471 TTTTTTTAAAGCACAGCTCTGGG - Intronic
1195782354 X:108479870-108479892 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1196023693 X:111017298-111017320 CTTTTCAAAGAGACATCTCTTGG - Intronic
1196074174 X:111556621-111556643 TTTTATTAAGAGACAAATCATGG + Intergenic
1196098721 X:111826741-111826763 TTTTCTTAAGAGATGGCTCTTGG + Intronic
1196669872 X:118354404-118354426 TTTTTTTAAGAGACAGAGTCTGG - Intronic
1196702091 X:118680880-118680902 TCTCTTTATGAGACACCTCTGGG - Intronic
1197062025 X:122192546-122192568 TTTTTTCAAGAAACAGCTCCTGG + Intergenic
1197084198 X:122453504-122453526 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1197167883 X:123398498-123398520 TTTATTTAAGAGATCTCTCTGGG - Intronic
1197203184 X:123766750-123766772 CTTTTTTAAAAGCCAGCTTTTGG + Intergenic
1197245047 X:124158999-124159021 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1197405086 X:126039193-126039215 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1197477360 X:126941334-126941356 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1197580183 X:128272967-128272989 ATTTTTTAAGAGGTTGCTCTGGG - Intergenic
1197644779 X:129005566-129005588 TTTTTTTAAGAAACATCTGGTGG - Intergenic
1197833522 X:130670892-130670914 TTTTTTTAAGATACATGACTTGG - Intronic
1198043112 X:132874208-132874230 TTTTTTGCAGGGGCAGCTCTAGG - Intronic
1198701299 X:139400291-139400313 TCCTTTTGAGAGACGGCTCTTGG + Intergenic
1198758573 X:140006750-140006772 TTTTGTTAAGACACTGTTCTTGG + Intergenic
1198780181 X:140226846-140226868 TTTTGTTAAGACACTGTTCTTGG - Intergenic
1198783041 X:140257802-140257824 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1198886761 X:141347438-141347460 TTTTTTCAAAAGCCAGCTCTTGG - Intergenic
1198892872 X:141418797-141418819 TTTTTTAAAGAGTCAACTTTTGG - Intergenic
1198934039 X:141887874-141887896 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1199021247 X:142881096-142881118 TTCTTTTGAAAAACAGCTCTTGG + Intergenic
1199024378 X:142919714-142919736 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1199040590 X:143111095-143111117 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1199144443 X:144348970-144348992 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1199174488 X:144769782-144769804 TTTTTTTTAGTGATTGCTCTAGG + Intergenic
1199310428 X:146314405-146314427 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1199340333 X:146670058-146670080 GTGTTTTAAGAAACAGCCCTTGG + Intergenic
1199371617 X:147056450-147056472 TTGTTTTAAGAAACAGATCTTGG - Intergenic
1199573422 X:149290358-149290380 TTTTTCTGAGAGACAGCACTAGG - Intergenic
1200521269 Y:4212025-4212047 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1200526254 Y:4278109-4278131 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1200651668 Y:5847744-5847766 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1200769936 Y:7114717-7114739 TTTTTTTTTGAAACAGCTGTAGG + Intergenic
1200973124 Y:9177715-9177737 TGCTTTGGAGAGACAGCTCTTGG - Intergenic
1200976628 Y:9218475-9218497 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1201796630 Y:17903416-17903438 TTCTTTGGAGAGACAGCTCCTGG - Intergenic
1201798426 Y:17926694-17926716 TCCTATTGAGAGACAGCTCTTGG + Intergenic
1201803127 Y:17979263-17979285 TCCTATTGAGAGACAGCTCTTGG - Intergenic
1201804925 Y:18002569-18002591 TTCTTTGGAGAGACAGCTCCTGG + Intergenic
1201929389 Y:19325144-19325166 TTTTTTTAAAAAAAAGCTTTTGG + Intergenic
1202137954 Y:21686798-21686820 TGCTTTGGAGAGACAGCTCTTGG + Intergenic
1202358014 Y:24072478-24072500 TTCTTTGGAGAGACAGCTCTTGG - Intergenic
1202512764 Y:25597635-25597657 TTCTTTGGAGAGACAGCTCTTGG + Intergenic