ID: 1046585788

View in Genome Browser
Species Human (GRCh38)
Location 8:116147749-116147771
Sequence AGTTATTTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046585783_1046585788 22 Left 1046585783 8:116147704-116147726 CCAAAACCCAGTAACAGGCCAAG No data
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data
1046585785_1046585788 15 Left 1046585785 8:116147711-116147733 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data
1046585784_1046585788 16 Left 1046585784 8:116147710-116147732 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data
1046585786_1046585788 4 Left 1046585786 8:116147722-116147744 CCAAGAGCTGTCTCTTAAAAAAA 0: 2
1: 7
2: 55
3: 316
4: 967
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data
1046585782_1046585788 25 Left 1046585782 8:116147701-116147723 CCACCAAAACCCAGTAACAGGCC No data
Right 1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046585788 Original CRISPR AGTTATTTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr