ID: 1046587768

View in Genome Browser
Species Human (GRCh38)
Location 8:116168536-116168558
Sequence ATGACCTTGAATAAAATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046587766_1046587768 13 Left 1046587766 8:116168500-116168522 CCAGGACAGATGATGTTTAAAAG No data
Right 1046587768 8:116168536-116168558 ATGACCTTGAATAAAATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046587768 Original CRISPR ATGACCTTGAATAAAATATC AGG Intergenic
No off target data available for this crispr