ID: 1046591309

View in Genome Browser
Species Human (GRCh38)
Location 8:116210478-116210500
Sequence ACCTCAGGTTGAATGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046591309_1046591313 5 Left 1046591309 8:116210478-116210500 CCTCAGTTCATTCAACCTGAGGT No data
Right 1046591313 8:116210506-116210528 GGGCTGCATTACTAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046591309 Original CRISPR ACCTCAGGTTGAATGAACTG AGG (reversed) Intergenic
No off target data available for this crispr