ID: 1046594545

View in Genome Browser
Species Human (GRCh38)
Location 8:116246383-116246405
Sequence CAAACATACCACCTTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046594541_1046594545 7 Left 1046594541 8:116246353-116246375 CCAATATAAGTCTGTATAAATCA No data
Right 1046594545 8:116246383-116246405 CAAACATACCACCTTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046594545 Original CRISPR CAAACATACCACCTTGATGG GGG Intergenic
No off target data available for this crispr