ID: 1046594783

View in Genome Browser
Species Human (GRCh38)
Location 8:116248595-116248617
Sequence GGCCATACAACCTGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046594780_1046594783 -1 Left 1046594780 8:116248573-116248595 CCTATTAAGGTTCAGTGTAGAGG No data
Right 1046594783 8:116248595-116248617 GGCCATACAACCTGTGTGTTTGG No data
1046594777_1046594783 23 Left 1046594777 8:116248549-116248571 CCGCTCAACAGAATGATAAAATG No data
Right 1046594783 8:116248595-116248617 GGCCATACAACCTGTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046594783 Original CRISPR GGCCATACAACCTGTGTGTT TGG Intergenic
No off target data available for this crispr