ID: 1046594791

View in Genome Browser
Species Human (GRCh38)
Location 8:116248654-116248676
Sequence CAGCACCACCTACAGCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046594791_1046594797 21 Left 1046594791 8:116248654-116248676 CCATGAAGCTGTAGGTGGTGCTG No data
Right 1046594797 8:116248698-116248720 TGGGCACGAGAACCGAGGAGTGG No data
1046594791_1046594798 28 Left 1046594791 8:116248654-116248676 CCATGAAGCTGTAGGTGGTGCTG No data
Right 1046594798 8:116248705-116248727 GAGAACCGAGGAGTGGAAGTAGG No data
1046594791_1046594794 2 Left 1046594791 8:116248654-116248676 CCATGAAGCTGTAGGTGGTGCTG No data
Right 1046594794 8:116248679-116248701 TTCCAGGAGCTACAATGCATGGG No data
1046594791_1046594796 16 Left 1046594791 8:116248654-116248676 CCATGAAGCTGTAGGTGGTGCTG No data
Right 1046594796 8:116248693-116248715 ATGCATGGGCACGAGAACCGAGG No data
1046594791_1046594793 1 Left 1046594791 8:116248654-116248676 CCATGAAGCTGTAGGTGGTGCTG No data
Right 1046594793 8:116248678-116248700 ATTCCAGGAGCTACAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046594791 Original CRISPR CAGCACCACCTACAGCTTCA TGG (reversed) Intergenic