ID: 1046594795

View in Genome Browser
Species Human (GRCh38)
Location 8:116248681-116248703
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046594795_1046594797 -6 Left 1046594795 8:116248681-116248703 CCAGGAGCTACAATGCATGGGCA No data
Right 1046594797 8:116248698-116248720 TGGGCACGAGAACCGAGGAGTGG No data
1046594795_1046594798 1 Left 1046594795 8:116248681-116248703 CCAGGAGCTACAATGCATGGGCA No data
Right 1046594798 8:116248705-116248727 GAGAACCGAGGAGTGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046594795 Original CRISPR TGCCCATGCATTGTAGCTCC TGG (reversed) Intergenic