ID: 1046596652

View in Genome Browser
Species Human (GRCh38)
Location 8:116269373-116269395
Sequence TGCTTGCCTCAGAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046596649_1046596652 0 Left 1046596649 8:116269350-116269372 CCTAGGTTTTAGCATCAGGATAA No data
Right 1046596652 8:116269373-116269395 TGCTTGCCTCAGAATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046596652 Original CRISPR TGCTTGCCTCAGAATGAGGG AGG Intergenic
No off target data available for this crispr