ID: 1046598772

View in Genome Browser
Species Human (GRCh38)
Location 8:116293421-116293443
Sequence TCTGTTTACCAAACACTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046598772_1046598775 8 Left 1046598772 8:116293421-116293443 CCATTCAGTGTTTGGTAAACAGA No data
Right 1046598775 8:116293452-116293474 AAGGCATCTAAGAATCAGCTAGG No data
1046598772_1046598776 9 Left 1046598772 8:116293421-116293443 CCATTCAGTGTTTGGTAAACAGA No data
Right 1046598776 8:116293453-116293475 AGGCATCTAAGAATCAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046598772 Original CRISPR TCTGTTTACCAAACACTGAA TGG (reversed) Intergenic
No off target data available for this crispr