ID: 1046613520

View in Genome Browser
Species Human (GRCh38)
Location 8:116450911-116450933
Sequence AATAATAATGAAGTTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046613520_1046613524 16 Left 1046613520 8:116450911-116450933 CCCTCTACAACTTCATTATTATT No data
Right 1046613524 8:116450950-116450972 AAACAGGATCCATGCCTTGTTGG No data
1046613520_1046613523 0 Left 1046613520 8:116450911-116450933 CCCTCTACAACTTCATTATTATT No data
Right 1046613523 8:116450934-116450956 AAGGACACATGTACAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046613520 Original CRISPR AATAATAATGAAGTTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr